Анемия группа: Анемия: классификация, профилактика, лечение. Справка

Содержание

Гематология: Анемия — диагностика и лечение в СПб, цена

Анемия — это состояние, при котором снижается количество гемоглобина и эритроцитов (красных кровяных клеток) в единице объема крови. Анемии вследствие кровопотери еще называют «постгеморрагическими» (от латинского post— «после» и греческого haimorrhagia — «кровотечение»).

Симптомы анемии

  • слабость,
  • головокружение,
  • утомляемость,
  • зябкость,
  • сонливость,
  • «мушки» перед глазами,
  • сердцебиение,
  • одышка при привычной физической нагрузке,
  • бледность кожи и слизистых оболочек.

У пожилых людей могут возникать и учащаться приступы стенокардии, у молодых женщин — нарушения менструального цикла. Объяснения подобному находят привычные: «устала», «стрессы в семье и на работе», «недосыпаю», «переработал».

Между тем, довольно часто — это признаки анемии.

Есть критерии анемии, принятые ВОЗ (Всемирной Организацией Здравоохранения). Они очень просты.  Диагноз «анемия» ставится при снижении концентрации гемоглобина: у мужчин — ниже 130 г/л, у женщин — ниже 120 г/л, у беременных женщин — ниже 110 г/л.


Гемоглобин – это безальтернативный переносчик кислорода ко всем клеткам и тканям человеческого организма. При снижении количества гемоглобина страдает доставка кислорода, отсюда и все признаки этого заболевания. 

Существуют разные группы анемий, их различают в основном по причинам развития.

Наиболее частые причины

  • Обильные или затяжные менструации.
  • Кровоточащий геморрой.
  • Желудочно-кишечные кровотечения.
  • Носовые кровотечения. 

Лечение

Поскольку данные анемии не являются самостоятельными заболеваниями,  то необходимо устранить вызвавшую их причину: удалить геморроидальный узел, проводить лечение язвенной болезни и т.

п. При прекращении кровотечений, как правило, прекращается и развитие анемии. В тяжелых случаях иногда бывает необходимо переливание крови. 

Железодефицитные анемии

Развиваются при недостаточном поступлении в организм железа, что приводит к нехватке строительного материала для гемоглобина.

Этот вид анемий является самым распространенным. По данным ВОЗ, железодефицитные анемии составляют в мире в среднем около 80% (в России этот показатель еще выше — более 90%).Наиболее часто болеют маленькие дети и женщины в детородном возрасте. 

Причины железодефицитных анемий
  • повышенная потребность в  железе вследствие ускоренного роста организма (у детей и подростков),
  • беременность и кормление грудью,
  • недостаточное поступление железа с пищей при вегетарианстве и голодании (несбалансированные диеты),
  • нарушение усвоения железа в желудке при гастрите с пониженной кислотностью, после операций на желудке.  
Лечение

Лечение назначается только после проведения полного обследования. Следует соблюдать специальную диету, основу которой составляют  продукты, богатые железом. Но одного лишь изменения режима питания  недостаточно, поэтому врачи назначают различные препараты железа: для приема внутрь в таблетках, капсулах, драже,  а иногда и в виде внутримышечных инъекций или внутривенных капельных введений. В тяжелых случаях может понадобиться переливание компонентов крови.

В

12   — дефицитные анемии

Развиваются при недостатке в организме витамина В12 (цианокобаламина).  Для образования эритроцитов требуются витамин В12 

 и фолиевая кислота. Витамин В12 поступает в организм с пищей. Для его всасывания необходим  внутренний фактор —вещество, которое вырабатывается в слизистой оболочке желудка. При дефиците витамина В12  нарушается нормальный обмен соединений фолиевой  кислоты, в результате чего в костном мозге вырабатываются чрезмерно крупные и перегруженные гемоглобином эритроциты. Эти сверхкрупные клетки легко разрушаются при движении по кровеносным сосудам.

Причины В
12 — дефицитных анемий
  • уменьшение выработки в желудке внутреннего фактора (атрофический гастрит, резекция желудка),
  • генетические (наследственные) факторы,
  • аутоиммунные заболевания щитовидной железы и сахарный диабет,
  • онкологические заболевания желудочно-кишечного тракта,
  • наличие паразитов (глистов).
Лечение
  • инъекции препаратов витамина В12,
  • прием фолиевой кислоты,
  • назначение специальной диеты,
  • переливание крови (в тяжелых случаях),
  • курс лечения глистогонными средствами (при паразитарных заболеваниях).

Гемолитические анемии

Это большая группа наследственных и приобретенных анемий, обусловленных повышенным разрушением эритроцитов (гемолизом).  

1. Приобретенные гемолитические анемии
  • Иммунные. Развиваются вследствие сбоя в иммунитете, когда начинают вырабатываться антитела не к болезнетворным микроорганизмам, а к своим собственным клеткам — эритроцитам.
  • Гемолитическая болезнь новорожденных. Развивается при резус-конфликте матери и плода.
  • Анемии при механическом повреждении эритроцитов (протезирование  клапанов сердца, гемолиз при хроническом гемодиализе — «искусственная почка»). При многократном контакте эритроцита с механическим препятствием разрушается его мембрана, и клетка просто изнашивается.
  • Анемии при инфекциях (малярия, токсоплазмоз). Эритроциты разрушаются болезнетворными микроорганизмами.
  • Анемии при воздействии внешних факторов: физических (ожоги), химических агентов, ядов (свинец).
2. Наследственные гемолитические анемии 

Развиваются при врожденном дефекте мембраны эритроцитов, что ведет к нарушению формы и размеров красных кровяных клеток. Срок жизни таких эритроцитов укорачивается. При  наследственной  гемолитической анемии довольно часто в молодом возрасте обнаруживаются камни в желчном пузыре.

Симптомы гемолитической анемии очень сходны с признаками заболевания печени (гепатита):
  • Желтушная окраска кожи и слизистых оболочек. Повышение уровня билирубина крови.При повышенном содержании в крови билирубин становится токсичным и вызывает тот же комплекс симптомов, что и при гепатите: тошноту, отсутствие аппетита, сухость во рту, общую слабость.
  • Увеличение селезенки. Сопровождается тяжестью и болью в левом подреберье.
  • Потемнение мочи за счет выделения билирубина и продуктов его разрушения.
Лечение

Лечение при гемолитической анемии проводится только в условиях стационара, поскольку признаки заболевания  во многом сходны с симптомами гепатита и цирроза печени, и правильно поставить диагноз очень трудно. При запоздалом лечении может развиться  гемолитический криз — угрожающее жизни состояние. Вследствие быстро развивающейся анемии резко нарастает сердечная слабость,  усиливается сердцебиение, падает артериальное давление.

Назначаются высокие дозы гормонов  — глюкокортикостероидов. При рецидивирующем течении болезни приходится удалять селезенку.

Апластическая анемия

Это заболевание, при котором происходит значительное уменьшение количества клеток всех  видов в крови в результате снижения выработки их в костном мозге. Признаки апластической анемии сходны с проявлениями лучевой болезни. Анемия сопровождается развитием сердечно-сосудистой недостаточности. Вследствие снижения количества тромбоцитов у больных имеется склонность к кровотечениям, кровоизлияниям, кровоточивости.

Снижение количества лейкоцитов вызывает ослабление иммунитета и,  как следствие, различные инфекционные осложнения: пневмонии, бронхиты, ангины, генерализованные грибковые поражения, а в наиболее тяжелых случаях — сепсис (заражение крови). Само заболевание обычно начинается с инфекционного процесса. Именно поэтому, если  температура тела повышена  более 3 суток, необходимо сделать анализ крови.

Лечение

В связи с тем, что апластическая анемия — один из наиболее тяжелых видов анемии, она требует обследования и лечения в специализированном стационаре. Лечение ее включает трансплантацию стволовых клеток,  иммуносупрессивную терапию (введение антилимфоцитарного иммуноглобулина, циклоспорина А). Используются также переливание компонентов крови, профилактика и лечение инфекционных осложнений. Назначаются антибиотики, больных стараются оградить от всех контактов, поскольку любая инфекция может вызывать самые серьезные осложнения.

Клиника высоких медицинских технологий им. Н. И. Пирогова располагает лабораторными и техническими возможностями для диагностики всех видов анемий. Ни в коем случае не следует лечиться с помощью «гуглотерапии», т. е. методом  самостоятельного подбора  лекарств на основании сведений из поисковых систем.   Эксперименты со своим здоровьем могут привести к потере драгоценного времени.  При появлении тревожных признаков нужно обратиться за помощью к специалистам. 

Анемия

Анемия – состояние, при котором количество эритроцитов и/или гемоглобина в крови становится ниже нормы.

Эритроциты и содержащийся в них гемоглобин участвуют в транспорте кислорода от легких к тканям. Без кислорода многие ткани и органы могут испытывать гипоксию (кислородное голодание), что крайне отрицательно сказывается на их работе. В зависимости от степени снижения уровня эритроцитов и/или гемоглобина анемия может быть легкой, умеренной или тяжелой.

Самой частой причиной анемии является дефицит железа.

Синонимы русские

Малокровие.

Синонимы английские

Anemia, Anaemia.

Симптомы

Несмотря на то что различные виды анемий вызываются разными причинами, симптомы у них очень схожи:

  • усталость,
  • слабость,
  • быстрая утомляемость,
  • головокружение,
  • бледность,
  • головная боль,
  • ощущение холода,
  • онемение конечностей,
  • одышка,
  • ощущение нехватки воздуха,
  • учащение сердцебиения,
  • боль в грудной клетке.

Кто в группе риска?

Анемия очень распространена и встречается и у женщин, и у мужчин разных возрастов. Однако существуют группы людей, которые подвержены развитию этого заболевания больше, чем другие:

  • те, кто употребляет с пищей мало железа и витаминов,
  • пациенты с хроническими заболеваниями почек, сахарным диабетом, раком, воспалительными заболеваниями кишечника,
  • люди, у чьих родственников была форма анемии, которая может передаваться по наследству,
  • пациенты с хроническими инфекциями, например туберкулезом или ВИЧ,
  • пациенты, потерявшие много крови после травмы или операции.

Общая информация о заболевании

Существует два основных механизма развития анемии:

  • уменьшение или нарушение образования эритроцитов, как при железодефицитной или апластической анемии,
  • уменьшение срока жизни эритроцитов в сосудистом русле, чрезмерное разрушение эритроцитов, как при гемолитической анемии.

Механизмы развития наиболее распространенных видов анемий

Вид анемии

Механизм

Возможные причины

Рекомендуемые тесты

Железодефицитная

Уменьшение количества железа в организме приводит к снижению гемоглобина и, как следствие, к снижению количества эритроцитов.

Кровопотеря, диета с низким содержанием железа, нарушенное всасывание железа.

Общий анализ крови (без лейкоцитарной формулы и СОЭ), железо в сыворотке, железосвязывающая способность сыворотки, трансферрин, ретикулоциты.

В12-дефицитная

Недостаток витамина В12 препятствует росту и развитию эритроцитов, а это в свою очередь вызывает снижение количества эритроцитов.

Отсутствие внутреннего фактора, диета с низким содержанием витамина B12, нарушение всасывания витамина В12.

Общий анализ крови (без лейкоцитарной формулы и СОЭ), витамин В12.

Апластическая

Уменьшение образования всех типов клеток в костном мозге, в том числе эритроцитов.

Противоопухолевая терапия, воздействие токсинов, аутоиммунные заболевания, вирусные инфекции.

Общий анализ крови (без лейкоцитарной формулы и СОЭ), ретикулоциты, эритропоэтин, скорость оседания эритроцитов (СОЭ).

Гемолитическая

Продолжительность жизни эритроцитов, которая в норме составляет около 120 дней, уменьшается из-за их разрушения в кровеносном русле.

Врождённые нарушения развития эритроцитов, реакции при переливании крови, аутоиммунные заболевания, прием некоторых лекарств.

Общий анализ крови (без лейкоцитарной формулы и СОЭ), ретикулоциты, билирубин.

Анемия при хронических заболеваниях

Различные длительно протекающие болезни приводят к уменьшению образования эритроцитов.

Заболевания почек, сахарный диабет, туберкулез, ВИЧ.

Общий анализ крови (без лейкоцитарной формулы и СОЭ), эритропоэтин, скорость оседания эритроцитов (СОЭ).

Все анемии можно разделить на 2 группы: острые и хронические. Хроническая развивается медленно, без явных симптомов, в течение длительного периода времени, например при хронических заболеваниях почек или при онкологии. При этом симптомы анемии могут быть сглажены проявлениями основного заболевания. Поэтому такой вид долго может оставаться нераспознанным.

Острая анемия возникает в результате резкой обильной кровопотери, например после повреждения кровеносных сосудов из-за травмы или при желудочно-кишечном кровотечении. Её симптомы проявляются сразу же: сильное головокружение, слабость, бледность, шум в ушах.

Диагностика

Основной метод выявления анемии – общий анализ крови, который показывает количество и соотношение различных клеток в кровяном русле. Он даёт возможность доктору оценить размер, форму и зрелость клеток крови. Могут быть назначены и другие исследования, такие как тест на ферритин, сывороточное железо и др. При уже диагностированной анемии для определения её вида используется биохимический анализ крови.

Лечение

Лечением наиболее распространённых форм анемий лёгкой степени чаще всего занимается терапевт. Исходя из результатов общего анализа крови, он может направить пациента к другому специалисту, например к гематологу.

Профилактика

Для профилактики анемии необходимо сбалансированное питание, и главное – оно должно быть разнообразным, потому что к этому заболеванию может привести недостаток различных веществ: железа, белков, витаминов группы В, фолиевой, аскорбиновой кислоты, меди, кобальта и т. д. К тому же, например, для удовлетворения потребности человека в железе следует, чтобы в рационе, помимо самого железа, были ещё и вещества, способствующие его усвоению, в первую очередь это витамин C.

Также рекомендуется

  • Общий анализ крови
  • Ретикулоциты
  • Витамин В12 (цианокобаламин)
  • Железо в сыворотке
  • Эритропоэтин
  • Скорость оседания эритроцитов (СОЭ)

что это, причины, факторы риска, лечение

Анемия – нехватка красных кровяных телец или содержащегося в них гемоглобина, из-за чего ухудшается снабжение тканей организма кислородом. Самый распространенный тип анемии вызывается недостатком железа в организме: железодефицитной анемией страдает от 1.5 до 2 миллиардов человек во всем мире.

В этой статье выясняем, кто рискует пострадать от недостатка железа, какие меры помогут избежать заболевания и как состояние микробиома влияет на лечение.

Содержание

Как понять, что вам не хватает железа?

ЖДА может проявляться общими для всех анемий признаками, с которыми нужно обязательно обращаться к врачу:

  • Крайняя усталость;
  • Слабость;
  • Бледная кожа;
  • Боль в груди;
  • Учащенное сердцебиение или одышка;
  • Головная боль, головокружение или дурнота;
  • Холодные руки и ноги.

Однако у дефицита железа есть и специфические признаки:

  • Воспаление или болезненность языка, стоматиты;
  • Ломкие ногти и выпадение волос;
  • Извращения вкуса – например необычная тяга попробовать лёд, мел, грязь или крахмал;
  • Плохой аппетит, особенно у младенцев и детей.

При любых симптомах только врач может поставить диагноз и выписать лечение. В большинстве случаев для того, чтобы понять, что это именно железодефицитная анемия, а не другая болезнь, понадобится анализ крови.

Причины ЖДА

При ЖДА на первый план выходит 2 проблемы – недостаточное потребление железа и слишком быстрая его потеря.

  • Кровотечения. Могут возникать при обильных менструациях, язвенной болезни желудка, полипах толстой кишки или раке кишечника.
  • Диета бедная железом и другими веществами. Витамин С и бета-каротин позволяют эффективнее усваивать железо, а цинк помогает регулировать метаболизм железа в организме.
  • Нарушения всасывания железа. Целиакия, болезнь Крона и язвенный колит не дают железу попадать в кровоток, так как стенки кишечника постоянно воспалены.
  • Беременность. У большинства беременных ЖДА появляется в результате возросшего объёма крови, а ещё растущий плод потребляет запасы гемоглобина из организма матери.

Кто больше всех рискует заболеть из-за нехватки железа в организме?

  • Женщины детородного возраста, особенно при обильных менструациях;
  • Беременные, недавно родившие и кормящие женщины;
  • Люди, перенесшие серьезную операцию или физическую травму;
  • Люди с воспалительными заболеваниями кишечника или целиакией;
  • Те, кто придерживается несбалансированной диеты. Особенно это касается вегетарианцев и веганов, которые не едят мясо, рыбу и птицу и не добавляют растительные источники железа в свою диету.
  • Дети грудного и ясельного возраста, которые выпивают более 700 миллилитров коровьего молока каждый день. Коровье молоко содержит мало железа и при этом может уменьшить абсорбцию железа из других источников.

Диета для предотвращения дефицита железа

Рекомендации по ежедневному употреблению железа:

  • Для мужчин любого возраста и женщин в постменопаузе — 8 мг/день;
  • Для женщин детородного возраста — 18 мг/день;
  • Максимальное количество железа, которое может перенести организм – 45 мг/день, при превышении этой дозы может возникнуть серьезное расстройство ЖКТ.

Первая рекомендация для профилактики ЖДА – увеличить потребление мяса, курицы, и яиц. Это продукты, богатые гемовым железом – самым легким для усвоения. Не обязательно запасаться жирной говядиной: 100 грамм говяжей печени содержат около 6.5 мг железа, а 100 грамм моллюсков могут содержать около 28 грамм – даже больше, чем нужно.

Помимо увеличения количества продуктов, богатых железом, вот несколько советов, которые помогут улучшить усвоение железа, даже если вы его получаете исключительно из растительных источников:

  • Сочетайте богатые железом продукты с витамином С: это особенно важно вегетаринцам, которые получают только негемовое железо. Витамин С предотвращает образование неабсорбируемых соединений и сохраняет железо в той форме, которая необходима для поглощения клетками слизистой оболочки нашего кишечника.
  • Бета-каротин также помогает сделать железо более доступным: тыква, морковь, батат, абрикосы и помидоры будут прекрасным дополнением к ежедневному меню.
  • Принимайте препараты железа и железосодержащую пищу отдельно от препаратов кальция и молочных продуктов: кальций препятствует усвоению железа. Попробуйте принимать добавки с железом за 2 часа до или после употребления любых молочных продуктов или препаратов кальция.
  • Ограничьте потребление продуктов с высоким содержанием фитатов: зерна, бобовые и орехи, которые не были пророщены или ферментированы, содержат соединение, называемое фитиновой кислотой, которая препятствует усвоению железа.
  • Ограничьте потребление кофе и чая: кофе даже без кофеина и чай содержат дубильные вещества, которые ухудшают всасывание железа.

Важно знать, что переизбыток железа тоже ведет к тяжелым расстройствам здоровья, поэтому стараться употреблять слишком большое количество железосодержащей пищи или принимать добавки при отсутствии рекомендаций врача не следует.

Как анемия связана с микробиомом?

Некоторые бактерии кишечника умеют преобразовывать негемовое железо в гемовое, то есть то, которое усваивается легче. Основным питанием для таких бактерий выступают фрукто- и олигосахариды, инулин и пектин, которые можно найти в самых простых продуктах: бананы, капуста, лук, чеснок, свёкла, яблоки, цикорий.

Ещё один способ повысить биодоступность железа с помощью бактерий – ферментация овощей.  Исследования показали, что употребление ферментированных овощей с едой увеличивает биодоступность железа даже при присутствии в рационе фитатов.

Употребление пробиотиков в биодобавках также может увеличивать всасываемость железа.

Но важно понимать, что пробиотики – это дополнительная терапия и при наличии анемии необходимы также препараты железа.


У взаимодействия микробиома с железом есть и другая сторона – препараты железа и усиленная железом пища могут изменять кишечный микробиом.  Железо важно как для организма-хозяина, так и для кишечных микроорганизмов. Патогенные штаммы особенно хорошо растут в условиях, богатых железом, благодаря их эффективности в его переработке. Отчасти этим ученые объясняют усиление симптомов воспалительных заболеваний кишечника при пероральном приеме железа. Поэтому при проблемах с ЖКТ необходимо особенно много внимания уделять микробиому – это снизит побочные эффекты и увеличит эффективность лечения, которое необходимо в любом случае.

Тест микробиоты Атлас поможет проанализировать состав микробиома и оценить его способность к расщеплению разных видов клетчатки и синтезу витаминов.

  • Sean R. Lynch, Why Nutritional Iron Deficiency Persists as a Worldwide Problem, 2011
  • Guus A.M. Kortman, Manuela Raffatellu, Dorine W. Swinkels, Harold Tjalsma, Nutritional iron turned inside out: intestinal stress from a gut microbial perspective, 2014
  • Bahtiyar Yilmaz, Hai Li, Gut Microbiota and Iron: The Crucial Actors in Health and Disease, 2018
  • Bobby J. Cherayil, Shiri Ellenbogen, Nandakumar N. Shanmugam, Iron and intestinal immunity, 2011
  • L Hallberg, M Brune, L Rossander, The role of vitamin C in iron absorption, 1989
  • Ekhard E Ziegler, Consumption of cow’s milk as a cause of iron deficiency in infants and toddlers, 2011
  • Kathryn L. Beck, Cathryn A. Conlon, Rozanne Kruger, Jane Coad, Dietary Determinants of and Possible Solutions to Iron Deficiency for Young Women Living in Industrialized Countries: A Review, 2014
  • Ioana Gabriela Rusu, Ramona Suharoschi, Dan Cristian Vodnar, Carmen Rodica Pop, Sonia Ancuța Socaci, Romana Vulturar, Magdalena Istrati, Ioana Moroșan, Anca Corina Fărcaș, Andreea Diana Kerezsi, Carmen Ioana Mureșan, Oana Lelia Pop , Iron Supplementation Influence on the Gut Microbiota and Probiotic Intake Effect in Iron Deficiency—A Literature-Based Review, 2020
  • M Layrisse, M N García-Casal, L Solano, M A Barón, F Arguello, D Llovera, J Ramírez, I Leets, E Tropper, New property of vitamin A and beta-carotene on human iron absorption: effect on phytate and polyphenols as inhibitors of iron absorption, 2020
  • Engin Kelkitli, Nurinnisa Ozturk, Nevin Alayvaz Aslan, Nurcan Kilic-Baygutalp, Zafer Bayraktutan, Nezahat Kurt, Nuri Bakan, Ebubekir Bakan, Serum zinc levels in patients with iron deficiency anemia and its association with symptoms of iron deficiency anemia, 2016

как определить анемию и узнать ее причины

Анемия может долго не проявлять себя, и человек понятия не имеет, что у него низкий гемоглобин. Но у анемии всегда есть причина, которую важно найти и устранить!

Признаками анемии считают частую усталость, физическую слабость, бледную кожу и слизистые. Железодефицитная анемия может также проявлять себя одышкой, головокружениями, шумом в ушах, внезапным учащением пульса. Кожа может стать сухой, ногти ломкими, слоистыми.

Правда, люди, особенно ведущие сидячий образ жизни, частенько списывают эти симптомы на то, что мало двигаются, набрали вес, не бывают на солнце.

Частые причины анемии

Факторов развития анемии довольно много. Перечислим самые распространенные.

Хроническая потеря крови — частая причина железодефицитной анемии у молодых женщин с обильными месячными. Для лечения врачи назначают либо препараты железа во время, до и после «критических дней», либо оральные контрацептивы, которые снижают интенсивность кровотечения. Однако потеря крови может происходить и из-за частых носовых или желудочно-кишечных кровотечений. Тут диагностика и лечение могут быть более сложными.

Нехватка железа, витамина В 12 (цианкобаламина), витамина В 9 (фолиевой кислоты) по отдельности или всех вместе может возникать из-за отсутствия в питании продуктов с этими веществами – это характерно для последователей очень жестких диет или постоянных ограничений в пище. Обычно мы получаем достаточно витаминов с пищей, если питание разнообразное, но могут быть трудности с усвоением витаминов.

Нередко причина нехватки железа – постоянные и малозаметные кровопотери, витамина В 12— нарушения в работе желудочно-кишечного тракта. Хронические гастриты, гастродуодениты, энтериты обычно приводят к анемии.

Повышенное кроверазрушение (гемолиз) тоже приводит к анемии. По окончании срока своей жизни (около 120 дней) эритроциты разрушаются в селезенке. При наличии гемолиза разрушение клеток крови происходит преждевременно, что приводит к уменьшению продолжительности жизни эритроцитов. Анемия развивается, когда костном мозге не успевает синтезировать достаточно эритроцитов взамен разрушенных.

Как проверить?

Комплекс лабораторных тестов «Гематологический, диагностика анемий» не только определит, есть у вас анемия, но и поможет установить ее причину. В него входит несколько комплексов и показателей.

Клинический анализ крови с лейкоцитарной формулой покажет количество всех клеток крови. Будет видно, есть ли у вас анемия, присутствует ли в организме воспалительный процесс, кровопотеря, нет ли подозрения на аллергию или  глистную инвазию.

Ретикулоциты — клетки-предшественники эритроцитов. Их количество показывает, насколько правильно идет процесс кроветворения в костном мозге.

Билирубин общий и прямой — желчный пигмент, конечный продукт распада гемоглобина.

Железо, витамин В 12, витамин В 9 — вещества, необходимые для синтеза гемоглобина.

Трансферрин — белок, которые переносит железо из кишечника в места синтеза и хранения крови (костный мозг, печень, селезенка). Его повышение или понижение указывает на разные причины анемии.

Ферритин — показатель, отражающий запас железа в клетках и тканях.

Латентная железосвязывающая способность сыворотки — способность трансферрина связывать железо. Свидетельствует о железодефиците.

Если часто болит живот…

С возрастом и при хронических заболеваниях ЖКТ часто начинаются проблемы с усвоением витамина В 12. Это может привести к  В 12-дефицитной анемии. Ее может сопровождать снижение мыслительных способностей, депрессивное состояние, покалывание пальцев или их периодическое онемение.

Выявить причину поможет лабораторный тест «Определение антител к фактору Кастла — внутреннему фактору (АВФ)». Внутренний фактор Кастла — белок, который вырабатывают клетки желудка. Именно он обеспечивает всасывание цианкобаламина в кишечнике. При аутоимунном гастрите собственные иммунитет организма синтезирует антитела, которые разрушают внутренний фактор Кастла. Чаще всего это бывает при атрофическом гастрите.

Своевременная сдача анализов и последующий визит к терапевту или гастроэнтерологу поможет без лишних затрат избавить от анемии и взять под контроль ее причины.

Публикации в СМИ

Апластические анемии — группа патологических состояний, характеризующихся панцитопенией в периферической крови вследствие угнетения кроветворной функции костного мозга.

Классификация • Врождённые (анемия Фанкони, Дайемонда–Блекфэна) • Приобретённые (результат воздействия химических, лекарственных, инфекционных агентов и ионизирующего излучения) • Идиопатические (причина заболевания неясна).

Этиология • Приобретённые анемии •• Инфекции (вирусные гепатиты, инфекционный мононуклеоз, ЦМВ, парвовирусная, грипп) •• Лимфопролиферативные нарушения (тимома, лимфома, хронический лимфобластный лейкоз) •• Ионизирующее излучение •• Токсины и химические вещества (бензол, инсектициды, соединения свинца и пр.) •• ЛС, например цитостатики, препараты золота, НПВС, противосудорожные препараты, антибиотики • Врождённые анемии (анемия Фанкони). Существует 4 группы комплементации, т. е. не менее 4 генов, мутация любого из которых ведёт к развитию апластической панцитопении 4 типов (все r) •• Группа А (тип 1 анемии Фанкони, *227650, 20q13.2–q13.3, дефекты генов FA1, FA, F, r) •• Группа В (тип 2, *227660, дефект гена FA2, r) •• Группа С (тип 3, *227645, 9q22.3, дефект гена FACC, r) •• Группа D (тип 4, *227646, дефект гена FA4, r).

Патогенез апластических анемий • Внутренний дефект гемопоэтических стволовых клеток • Иммунная реакция на гемопоэтическую ткань • Нарушение поддерживающей функции стромального окружения в костном мозге

Клиническая картина

• Характерные черты апластических анемий •• Общие признаки (одышка, бледность кожных покровов и слизистых оболочек, тахикардия, слабость, систолический шум на верхушке сердца, снижение массы тела) •• Частое присоединение инфекционно-воспалительных и гнойно-некротических процессов различной локализации вследствие лейкопении (нейтропении) •• Геморрагический синдром: крупные и мелкие кровоизлияния (в т. ч. в сетчатку глаза), кровотечения различной локализации (меноррагия, мелена, носовые кровотечения), обусловленные тромбоцитопенией. Особенности у детей • Преобладающий возраст — 14–16 лет • Анемии обычно предшествует перенесённое инфекционное заболевание (ветряная оспа, краснуха, вирусные гепатиты) • Заболевание развивается очень быстро • В 70% случаев при лечении циклоспорином удаётся достичь полной клинико-гематологической ремиссии.

• Анемия Фанкони. Существует 2 типа •• Классический (тип I) ••• Низкий рост ••• Микроцефалия ••• Деформации скелета (отсутствие или гипоплазия первой пястной или лучевой кости) ••• Аномалии почек и сердца ••• Гипоспадия ••• Гиперпигментация кожи ••• Глухота •• Тип 2 характеризуется наличием малых аномалий развития.

• Врождённая апластическая анемия (синдром Дайемонда–Блекфэна) — аллельный вариант анемии Фанкони (*205900, r). От анемии Фанкони её отличают раннее появление анемии (как правило, в первые месяцы жизни), отсутствие нейтропении и тромбоцитопении.

По тяжести различают нетяжёлую (гранулоциты меньше 1,5´109/л, тромбоциты 100´109/л, мегакариоциты меньше 80´109/л) и тяжёлую (в периферической крови гранулоциты менее 0,5´109/л, тромбоциты менее 20´109/л; в костной ткани преобладание фиброзной ткани более чем на 60%) формы.

ЛАБОРАТОРНЫЕ ИССЛЕДОВАНИЯ

• Приобретённая анемия •• Панцитопения •• Нормохромные эритроциты •• Удлинённое время кровотечения •• Выраженное снижение содержания ретикулоцитов (арегенераторная анемия) •• Повышение концентрации железа в сыворотке крови (вследствие гемотрансфузий) •• Нормальные показатели общей железосвязывающей способности сыворотки (ОЖСС) •• Концентрация эритропоэтина сыворотки обычно увеличена пропорционально степени анемии •• Нарушение показателей функций печени.

• Анемия Фанкони •• Макроцитоз (в отличие от приобретённой апластической анемии) •• Повышение содержания HbF •• Отсутствие выраженной панцитопении до 3–8-летнего возраста •• Характерны ломкость хромосом, дефекты репарации, повышенная чувствительность хромосом к диэпоксибутану, митомицину и УФО.

• Анемия Дайемонда–Блекфэна: макроцитоз, ретикулоцитопения, повышенное содержание HbF.

Пункция костного мозга • Увеличенные запасы железа • Уменьшено количество клеток •• Уменьшение количества мегакариоцитов •• Уменьшение количества миелоцитов •• Уменьшение количества эритроидных предшественников •• Замещение нормальной кроветворной ткани на жировую и фиброзную • Анемия Фанкони — при пункции костного мозга часто не обнаруживают изменений.

Инструментальные исследования • КТ области тимуса при подозрении на тимому • Рентгенологическое исследование костей предплечья (возможно обнаружение аномалий развития лучевой кости) и больших пальцев кистей (конституциональная анемия) • УЗИ почек.

Дифференциальная диагностика • Транзиторная эритробластопения у детей • Миелодиспластический синдром • Пароксизмальная ночная гемоглобинурия • Острый лейкоз • Волосатоклеточный лейкоз • СКВ • Диссеминированная инфекция • Гиперспленизм • Анемии при гипотиреозе, гипопитуитаризме и заболеваниях печени.

ЛЕЧЕНИЕ

Тактика ведения • Стационарное лечение в гематологическом отделении. При нейтропении показана изоляция для предупреждения возможного инфицирования • Исключение причинных факторов • Исследование Аг системы HLA больных и членов их семей.

Трансплантация костного мозга пациентам с выраженной апластической анемией, особенно в возрасте до 30 лет — метод выбора (при наличии HLA-идентичного донора) • Трансплантация от неродственных доноров в случае неэффективности проводимого лечения.

Консервативное лечение

• Проводят при отсутствии донора для трансплантации костного мозга •• Глобулин антитимоцитарный. Для выявления повышенной чувствительности сначала необходимо проведение кожной пробы ••• Препарат выбора для лечения пациентов пожилого возраста или при отсутствии донора для трансплантации костного мозга ••• Курсовая доза 160 мг/кг, разделённая на 4 дозы, в течение первых 4 дней лечения ••• Необходимую дозу препарата растворяют в 500 мл 0,9% р-ра натрия хлорида и вводят в/в капельно в течение 4–6 ч ••• Развитие анафилактической реакции — абсолютное противопоказание к дальнейшему введению препарата •• Циклоспорин ••• Начальная доза — 5 мг/кг/сут внутрь или 3 мг/кг в/в. Далее дозы подбирают, исходя из концентрации циклоспорина в крови, определяемой ежедневно ••• При отсутствии эффекта в течение 120 дней препарат отменяют •• Метилпреднизолон — по 2 мг/кг/сут в/в с 1 по 14 день лечения, по 1 мг/кг — с 15 по 21 день •• Гранулоцитарный колониестимулирующий фактор (например, молграмостим) — при неэффективности тимоглобулина или циклоспорина ••• Начальная доза — 5 мкг/кг/сут п/к до увеличения количества гранулоцитов более 1 000/мкл ••• При отсутствии эффекта в течение 14 дней дозу удваивают •• Андрогены эффективны при некоторых вариантах анемии Фанкони, приобретённой апластической анемии, хотя случаи успешного лечения крайне редки. При отсутствии эффекта в течение 4–6 мес препарат отменяют постепенно.

• Поддерживающая терапия •• Оксигенотерапия •• Санация полости рта и других слизистых оболочек •• Переливание отмытых эритроцитов через лейкоцитарные фильтры; тромбоцитарной массы •• Антибактериальная терапия •• Гемостатики

• Осложнения терапии • Геморрагический синдром • Инфекционные осложнения • Гемосидероз при переливании крови • Сердечная недостаточность • Почечная недостаточность • Токсический гепатит • Анафилактический шок и сывороточная болезнь (при использовании антитимоцитарного глобулина) • Развитие острого лейкоза.

Оперативное лечение • Тимэктомия при тимоме.

Исходы лечения • Полная клинико-гематологическая ремиссия: концентрация Hb выше 110 г/л, тромбоцитов более 100´109/л, гранулоцитов более 1,5´109/л • Частичная клинико-гематологическая ремиссия: концентрация Hb 90–110 г/л, тромбоцитов 30–100´109/л, гранулоцитов 0,5–1,5´109/л • Минимальный гематологический ответ: уровень Hb 80–90 г/л, тромбоцитов более 10–30´109/л (без проведения трансфузий).

Течение и прогноз • Приобретённая анемия. Течение и прогноз прямо пропорциональны возрасту больного. При отсутствии своевременной и адекватной терапии 80% пациентов погибают в течение 3 мес от манифестации заболевания. С внедрением в клиническую практику циклоспорина шансы на продление жизни больного увеличились. При предполагаемой трансплантации костного мозга во избежание сенсибилизации в предоперационный период желательно избегать переливаний препаратов крови (в особенности от родственников) • Анемия Фанкони. Выживаемость не превышает 4 лет при изолированной заместительной терапии. Прогноз значительно благоприятнее при эффективности андрогенов или трансплантации костного мозга.

Синонимы: Для анемии Фанкони — синдром Фанкони.

МКБ-10 • D60 Приобретённая чистая красноклеточная аплазия [эритробластопения] • D61 Другие апластические анемии

Примечания • Аплазия костного мозга — врождённое или приобретённое тяжёлое состояние, проявляющееся панцитопенией. Врождённая форма сочетается с фенотипическими и цитогенетическими аномалиями, что облегчает диагностику • Панцитопения — снижение количества эритроцитов, лейкоцитов и тромбоцитов. Характерны бледность и сонливость, инфекции, обусловленные нейтропенией; геморрагический диатез вследствие тромбоцитопении. Для дифференциальной диагностики необходимо исследование костного мозга (аплазия [чаще гипоплазия] костного мозга, вытеснение ростков костного мозга бластными клетками, аутоиммунное разрушение клеток крови — синдром Эванса) • Конституциональными называют врождённые и иногда идиопатические типы анемий.

D51 — Витамин-в12-дефицитная анемия — список препаратов нозологической группы в справочнике МКБ-10

Название Форма выпуска Владелец рег. уд.
B12 Анкерманн

Таб., покр. оболочкой 1 мг: 50 или 100 шт.

рег. №: ЛП-N (000075)-(РГ- RU) от 24.08.20
WOERWAG PHARMA (Германия) Произведено: ARTESAN PHARMA (Германия) контакты:
ВЕРВАГ ФАРМА ООО (Россия)
Фероглобин-В 12

Сироп: фл. 50 мл или 200 мл

рег. №: П N016014/01 от 10.09.09
VITABIOTICS (Великобритания)
Цианокобаламин

Р-р д/инъекц. 0.2 мг/мл: 1 мл амп. 5 или 10 шт.

рег. №: ЛП-002681 от 28.10.14
АТОЛЛ (Россия) Произведено: ОЗОН ФАРМ (Россия)
Цианокобаламин

Р-р д/инъекц. 0.5 мг/мл: 1 мл амп. 5 или 10 шт.

рег. №: ЛП-002681 от 28.10.14
АТОЛЛ (Россия) Произведено: ОЗОН ФАРМ (Россия)
Цианокобаламин

Р-р д/инъекц. 200 мкг/1 мл: амп. 1, 5, 10 или 20 шт.

рег. №: Р N003084/01 от 05.10.09
НОВОСИБХИМФАРМ (Россия)
Цианокобаламин

Р-р д/инъекц. 200 мкг/1 мл: амп. 10 шт.

рег. №: П N015993/01 от 16.09. 09
БОРИСОВСКИЙ ЗАВОД МЕДИЦИНСКИХ ПРЕПАРАТОВ (Республика Беларусь)
Цианокобаламин

Р-р д/инъекц. 200 мкг/1 мл: амп. 10 шт.

рег. №: ЛС-000077 от 12.01.10
ДАЛЬХИМФАРМ (Россия)
Цианокобаламин

Р-р д/инъекц. 200 мкг/1 мл: амп. 10 шт.

рег. №: ЛС-000263 от 05.03.10
МОСХИМФАРМПРЕПАРАТЫ им. Н.А.Семашко (Россия)
Цианокобаламин

Р-р д/инъекц. 200 мкг/1 мл: амп. 10 шт.

рег. №: П N014381/01 от 26. 12.08
ЛЬВОВДИАЛЕК ДП ГАК УКРМЕДПРОМ (Украина)

Реклама

Цианокобаламин

Р-р д/инъекц. 500 мкг/1 мл: амп. 1, 5, 10 или 20 шт.

рег. №: Р N003084/01 от 05.10.09
НОВОСИБХИМФАРМ (Россия)
Цианокобаламин

Р-р д/инъекц. 500 мкг/1 мл: амп. 10 шт.

рег. №: П N015993/01 от 16.09.09
БОРИСОВСКИЙ ЗАВОД МЕДИЦИНСКИХ ПРЕПАРАТОВ (Республика Беларусь)
Цианокобаламин

Р-р д/инъекц. 500 мкг/1 мл: амп. 10 шт.

рег. №: ЛС-000077 от 12.01.10
ДАЛЬХИМФАРМ (Россия)
Цианокобаламин

Р-р д/инъекц. 500 мкг/1 мл: амп. 10 шт.

рег. №: ЛС-000095 от 26.01.10
СТАТУСФАРМ (Россия) Произведено: ЕРЕВАНСКАЯ ХИМИКО — ФАРМАЦЕВТИЧЕСКАЯ ФИРМА (Армения)
Цианокобаламин

Р-р д/инъекц. 500 мкг/1 мл: амп. 10 шт.

рег. №: ЛС-000263 от 05.03.10
МОСХИМФАРМПРЕПАРАТЫ им. Н.А.Семашко (Россия)
Цианокобаламин

Р-р д/инъекц. 500 мкг/1 мл: амп. 10 шт.

рег. №: П N014381/01 от 26. 12.08
ЛЬВОВДИАЛЕК ДП ГАК УКРМЕДПРОМ (Украина)
Цианокобаламин буфус

Р-р д/инъекц. 500 мкг/1 мл: амп. 10 или 100 шт.

рег. №: ЛП-000186 от 25.01.11 Дата перерегистрации: 22.03.16
ОБНОВЛЕНИЕ (Россия)
Цианокобаламин-Виал

Р-р д/инъекц. 200 мкг/1 мл: амп. 10 шт.

рег. №: ЛСР-001942/09 от 16.03.09
ВИАЛ (Россия) Произведено: CSPC OUYI PHARMACEUTICAL (Китай)
Цианокобаламин-Виал

Р-р д/инъекц. 200 мкг/1 мл: амп. 10, 100 или 2000 шт. (упаковано Озон ООО)

рег. №: ЛСР-001942/09 от 16.03.09
ВИАЛ (Россия) Произведено: CSPC OUYI PHARMACEUTICAL (Китай) Упаковано: ОЗОН (Россия)
Цианокобаламин-Виал

Р-р д/инъекц. 500 мкг/1 мл: амп. 10 шт.

рег. №: ЛСР-001942/09 от 16.03.09
ВИАЛ (Россия) Произведено: CSPC OUYI PHARMACEUTICAL (Китай)
Цианокобаламин-Виал

Р-р д/инъекц. 500 мкг/1 мл: амп. 10, 100 или 2000 шт. (упаковано Озон ООО)

рег. №: ЛСР-001942/09 от 16.03.09
ВИАЛ (Россия) Произведено: CSPC OUYI PHARMACEUTICAL (Китай) Упаковано: ОЗОН (Россия)
Цикомин-Альтфарм

Супп. ректальные 500 мкг: 10 шт.

рег. №: ЛСР-006594/08 от 14.08.08
АЛЬТФАРМ (Россия)
Название Форма выпуска Владелец рег. уд.
Ферро-Фольгамма®

Капс. 112.6 мг+10 мкг+5 мг: 20 или 50 шт.

рег. №: П N012666/01 от 19.08.11 Дата перерегистрации: 29.12.14
WOERWAG PHARMA (Германия) Произведено: CATALENT GERMANY EBERBACH (Германия) Упаковано: C. P.M. ContractPharma (Германия)
Цианокобаламин (Витамин В12)

Р-р д/инъекц. 200 мкг/1 мл: амп. 10 шт.

рег. №: ЛС-000959 от 05.02.09 Дата перерегистрации: 21.10.15
ВЕРОФАРМ (Россия)
Цианокобаламин (Витамин В12)

Р-р д/инъекц. 500 мкг/1 мл: амп. 10 шт.

рег. №: ЛС-000959 от 05.02.09 Дата перерегистрации: 21.10.15
ВЕРОФАРМ (Россия)

симптомы, лечение, степени тяжести, причины, классификация и диагностика малокровия

Даниил Давыдов

медицинский журналист

Профиль автора

По данным ВОЗ, анемия есть у 24,8% всего населения Земли, это 1,6 миллиарда человек.

Больше всего пациентов с анемией среди детей и молодых женщин. Тем не менее знать, что такое анемия и откуда она берется, важно всем, потому что риск заболеть некоторыми видами анемии есть у каждого человека вне зависимости от пола и возраста.

Сходите к врачу

Наши статьи написаны с любовью к доказательной медицине. Мы ссылаемся на авторитетные источники и ходим за комментариями к докторам с хорошей репутацией. Но помните: ответственность за ваше здоровье лежит на вас и на лечащем враче. Мы не выписываем рецептов, мы даем рекомендации. Полагаться на нашу точку зрения или нет — решать вам.

Что такое анемия

Анемия — уменьшение массы красных кровяных клеток, то есть эритроцитов, в организме человека. Эритроциты доставляют кислород из легких к органам и тканям и забирают из них углекислый газ. Это возможно благодаря гемоглобину — богатому железом белку, который придает крови красный цвет.

Анемия — международный справочник для врачей Medscape

Сложное строение гема позволяет железу присоединять кислород Сложное строение гема позволяет железу присоединять кислород

Когда масса эритроцитов уменьшается, клетки, из которых состоит наш организм, начинают понемногу задыхаться. Сначала человек может этого даже не ощущать. Но если не устранить причину анемии, со временем она может привести к проблемам со здоровьем.

Чем опасны анемии — бюллетень Американской академии семейных врачей

Все начинается с необъяснимой усталости, снижения работоспособности и мышечной слабости. Но со временем дефицит кислорода может привести к сердечной недостаточности и даже к смерти. Дети с анемией развиваются медленнее ровесников, а у беременных женщин выше риск родить ребенка с низкой массой тела и чаще случаются преждевременные роды.

Анемия — не болезнь, а проявление основного заболевания. Чтобы вылечить анемию, сначала нужно установить ее истинную причину. А причин может быть очень много.

Оценка анемии — руководство для врачей MSD

НОВЫЙ КУРС

Курс о больших делах

Разбираемся, как начинать и доводить до конца масштабные задачи

Покажите!

Причины анемии

Чаще всего баланс между рождением и гибелью эритроцитов нарушается по трем причинам.

Потеря крови. Анемии, которые развились из-за кровопотери, врачи называют постгеморрагическими. Их делят на две формы — острую и хроническую.

Анемии из-за сильного кровотечения — руководство для врачей MSD

К острой анемии приводит ситуация, когда человек в течение нескольких часов теряет большое количество крови. Такое случается, например, при травмах. Вместе с кровью теряются и эритроциты, а новые вырабатываться не успевают.

Железо хранится в печени и мышцах — бюллетень Национального института здоровья США

К хронической анемии приводит ситуация, когда человек теряет кровь в течение нескольких дней, недель или даже месяцев, постепенно и незаметно. Такое бывает при внутренних кровотечениях — например, при язве желудка или чересчур обильных менструациях.

В нормальных условиях организм пополняет запасы железа из погибших эритроцитов и из пищи. При хронической кровопотере забирать железо из утраченных эритроцитов он не может, а из пищи за сутки всасывается всего 3 мг железа. Если учесть, что при ежедневной потере всего одной чайной ложки крови человек теряет целых 2,5 мг железа, этого явно недостаточно.

Диагностика и лечение железодефицитной анемии в 21 веке — журнал «Терапевтические достижения в гастроэнтерологии»

Может ли кровотечение вызвать железодефицитную анемию? — международный справочник для врачей Medscape

Чтобы вырабатывать новые эритроциты взамен утраченных, организму приходится использовать «неприкосновенные запасы» железа, которые хранятся в печени, селезенке, костном мозге и мышцах. Если не устранить внутреннее кровотечение и не пополнить запасы, может развиться железодефицитная анемия.

Ускоренное разрушение эритроцитов. Анемии, при которых в организме образуется достаточно эритроцитов, но живут они недолго, называются гемолитическими. Они могут быть связаны с наследственными заболеваниями крови. Например, с талассемией, при которой нарушается производство гемоглобина, или с серповидноклеточной анемией, при которой образуются похожие на месяц короткоживущие эритроциты.

Гемолитические анемии — бюллетень Национального института сердца легких и крови США

Талассемия — буклет клиники Майо

Серповидноклеточная анемия — бюллетень Национального института сердца, легких и крови США

Как отличить приобретенную гемолитическую анемию от врожденной — международный справочник для врачей Medscape

Но иногда гемолитической анемией может заболеть изначально здоровый человек. Болезнь может спровоцировать бактериальная, вирусная или паразитарная инфекция, прием некоторых лекарств, аутоиммунная реакция, при которой эритроциты разрушает собственная иммунная система, или переливание крови неподходящей группы.

Недостаточное образование эритроцитов. Анемии, при которых организм не в состоянии создавать столько эритроцитов, сколько нужно для нормального снабжения кислородом, называются гипопролиферативными. Их делят на три формы.

Анемии из-за недостаточного образования эритроцитов — руководство для врачей MSD

Микроцитарные анемии возникают из-за проблем с поглощением железа из желудочно-кишечного тракта — как, например, у пациентов с целиакией или воспалением слизистой желудка — гастритом или язвой.

Анемия, вызванная низким содержанием железа у взрослых — международный учебник для врачей Uptodate

Полноценно питающимся взрослым мужчинам вполне хватает железа, которое они получают вместе с едой. Но у некоторых групп людей дефицит железа встречается чаще. К ним относятся:

  1. Вегетарианцы, которые не едят богатого железом мяса.
  2. Некоторые женщины, которые теряют слишком много железа с менструациями.
  3. Беременные, которые «делятся» своим железом с плодом.
  4. Маленькие дети, которые тратят железо на рост.

Апластическую анемию могут спровоцировать вирусы, радиация, лекарства и даже беременность — руководство для врачей MSD

Раз железа не хватает, гемоглобина синтезируется немного. А поскольку эритроциты становится нечем заполнить, они получаются маленькими. Хотя причина и не в кровопотере, в итоге тоже может развиться железодефицитная анемия.

При нормоцитарных анемиях эритроциты нормального размера, но их очень мало. Такое случается либо при генетических нарушениях, либо вследствие заболеваний костного мозга, в котором в итоге образуется меньше эритроцитов, чем нужно, вроде апластической анемии.

При макроцитарных анемиях эритроциты получаются большими, но они бедны гемоглобином, и их образуется слишком мало, чтобы обеспечивать нормальный газообмен. Чаще всего макроцитарная анемия развивается из-за нехватки витамина В9 или витамина В12.

Классификация анемий

Классификаций анемий очень много, но чаще всего их делят на четыре типа.

Железодефицитные анемии встречаются чаще всего — на них приходится примерно 80% всех анемий. Связаны либо с кровотечениями, например после операции или в результате травмы, либо с несбалансированным питанием, в котором не хватает продуктов, которые могли бы быть источников железа, например при строгой веганской диете.

Анемии, связанные с хроническими болезнями. По некоторым данным, от анемий, которые возникли из-за заболеваний, с которыми люди живут много лет, страдает 30—50% всех пожилых людей. Причинами анемии становятся онкологические и аутоиммунные заболевания, хронические болезни почек.

Анемии, связанные с нехваткой витаминов В9 и В12, есть у 0,1% всех жителей Северной Европы. Дефицит витамина В9, или фолиевой кислоты, чаще всего встречается у беременных при плохом питании, у людей с воспалительными заболеваниями кишечника и при алкоголизме: при этих состояниях нарушается всасывание фолиевой кислоты.

Дефицит витамина В12 может развиться у веганов, потому что витамин В12 есть только в пище животного происхождения, при наследственных заболеваниях, у людей с воспалительными заболеваниями кишечника, при которых нарушается всасывание этого вещества, и у пациентов с заболеваниями желудка, при котором нарушается выработка веществ, необходимых для усвоения витамина В12.

Анемии, связанные с генетическими нарушениями, встречаются редко. Дальше мы будем рассказывать о тех видах анемий, которые встречаются чаще всего.

Анемия может развиться по разным причинам — вот основные из них

Симптомы анемии

Проявления анемии, особенно на ранних стадиях, очень похожи на симптомы обычной усталости или профессионального выгорания. Многие люди вообще не чувствуют никакого дискомфорта, либо же у них неспецифические симптомы, которые могут указывать на множество разных заболеваний, а не на одно конкретное.

Поэтому заподозрить болезнь, ориентируясь только на симптомы, сложно.

Симптомы анемии — бюллетень клиники Майоv

Признаки анемии:

  1. Быстрая утомляемость.
  2. Бледная или желтоватая кожа.
  3. Регулярные головокружения и головные боли.
  4. Боли в груди.
  5. Аритмии, то есть нерегулярное сердцебиение.
  6. Одышка.
  7. Мышечная слабость.
  8. Холодные руки и ноги.

Какой врач лечит анемию

Как правило, люди с симптомами, похожими на анемию, обращаются к терапевту. Если врач заподозрит, что у пациента анемия, он может направить его к специалисту — врачу-гематологу. Стоимость приема у терапевта в Москве — в среднем 2500 Р, у гематолога — в среднем 4000 Р.

Обследование при анемии — международный справочник для врачей Medscape

Как пациенты попадают к гематологу

Римма Цветнова

гематолог клиники доказательной медицины DocMed

Основная часть моих пациентов — дети, у которых выявлена анемия во время плановой диспансеризации в возрасте одного года, или взрослые, которые самостоятельно решили сдать анализы и обнаружили в них изменения. Иногда другие врачи направляют ко мне сложных пациентов, при лечении которых возникли трудности. Но таких значительно меньше.

Диагностика анемии

Шаг 1. Убедиться, что у пациента действительно анемия, а не какое-то другое заболевание.

Для этого врач проведет внешний осмотр пациента: обратит внимание на цвет кожи, оценит размер лимфатических узлов и селезенки, расспросит о боли в костях, хронических заболеваниях и о лекарствах, которые тот принимает.

Затем врач назначит общий анализ крови с обязательной микроскопией мазка — это позволяет оценить форму и размеры эритроцитов, а также скоростью оседания эритроцитов (СОЭ).

Общий анализ крови включает определение концентрации гемоглобина, гематокрит — объем эритроцитов в крови, который выражается в процентах, и другие показатели, которые описывают состояние красных кровяных клеток.

Однако на первом этапе обследования врач обращает внимание прежде всего на уровень гемоглобина — это основной критерий для постановки диагноза «анемия».

Уровень гемоглобина в г/л у разных групп людей как диагностический критерий анемии по ВОЗ

Группа Норма Начальная форма анемии Умеренная форма анемии Тяжелая форма анемии
Дети от 6 месяцев до 5 лет 110 и выше 100—109 70—99 Ниже 70
Дети 5—11 лет 115 и выше 110—114 80—109 Ниже 80
Дети 12—14 лет 120 и выше 110—119 80—109 Ниже 80
Женщины от 15 лет и старше 120 и выше 110—119 80—109 Ниже 80
Беременные женщины 110 и выше 100—109 70—99 Ниже 70
Мужчины от 15 лет и старше 130 и выше 110—129 80—109 Ниже 80

Дети от 6 месяцев до 5 лет

Норма

110 и выше

Начальная форма анемии

100—109

Умеренная форма анемии

70—99

Тяжелая форма анемии

Ниже 70

Норма

115 и выше

Начальная форма анемии

110—114

Умеренная форма анемии

80—109

Тяжелая форма анемии

Ниже 80

Норма

120 и выше

Начальная форма анемии

110—119

Умеренная форма анемии

80—109

Тяжелая форма анемии

Ниже 80

Женщины от 15 лет и старше

Норма

120 и выше

Начальная форма анемии

110—119

Умеренная форма анемии

80—109

Тяжелая форма анемии

Ниже 80

Беременные женщины

Норма

110 и выше

Начальная форма анемии

100—109

Умеренная форма анемии

70—99

Тяжелая форма анемии

Ниже 70

Мужчины от 15 лет и старше

Норма

130 и выше

Начальная форма анемии

110—129

Умеренная форма анемии

80—109

Тяжелая форма анемии

Ниже 80

Стоимость общего анализа крови с обязательной микроскопией мазка и СОЭ вместе со взятием крови — в пределах 1100 Р.

Шаг 2. Разобраться в причинах анемии — от этого будет зависеть метод лечения.

На этом этапе врач изучит результаты общего анализа крови и мазка. Эти данные позволяют понять, какой тип анемии у пациента: микроцитарный, нормоцитарный или макроцитарный.

Чтобы уточнить диагноз, врач может назначить дополнительные анализы. При подозрении на железодефицитную анемию гематологи обычно назначают анализы крови: на уровень железа, общую железосвязывающую способность сыворотки, на уровень ферритина — в составе этого белка железо запасается в тканях и на уровень трансферрина — в составе этого белка железо запасается в печени.

  1. Анализ на уровень железа вместе со взятием крови — в пределах 500 Р.
  2. Анализ на общую железосвязывающую способность вместе со взятием крови — в пределах 550 Р.
  3. Анализ на трансферрин вместе со взятием крови — в пределах 850 Р.
  4. Анализ на ферритин вместе со взятием крови — в пределах 900 Р.

При подозрении на внутреннее кровотечение пациента могут направить на анализ кала на скрытую кровь, на эндоскопию или на рентгеновское исследование:

  1. Анализ кала на скрытую кровь, самостоятельный сбор биоматериала — в пределах 400 Р.
  2. Эндоскопия в зависимости от зоны — от 330 Р.
  3. Рентген брюшной полости — от 568 Р.

При подозрении на В12-дефицитную или фолиеводефицитную анемию доктора назначают анализы на эти витамины:

  1. Анализ на витамин В12 вместе со взятием крови — в пределах 1100 Р.
  2. Анализ на витамин В9 вместе со взятием крови — в пределах 1200 Р.

Если врач решит, что все дело в хроническом заболевании, он может заказать анализы на маркеры воспаления: например, СОЭ и С-реактивный белок или биохимический анализ крови или мочи. Почти все эти анализы можно сдать по полису ОМС или в частной лаборатории за деньги.

  1. Анализ на С-реактивный белок вместе со взятием крови — в пределах 750 Р.
  2. Базовый биохимический анализ вместе со взятием крови — в пределах 2300 Р.
  3. Анализ мочи, самостоятельный сбор биоматериала — в пределах 350 Р.

Нужно ли идти к врачу, если у человека много лет низкий гемоглобин, но хорошее самочувствие

Римма Цветнова

гематолог клиники доказательной медицины DocMed

Снижение гемоглобина проявляет себя коварно: если человек потерял много крови сразу и у него резко упал гемоглобин, то это ощутимо скажется на его самочувствии и понадобится помощь врача. Но при постепенном снижении гемоглобина организм успевает привыкнуть к новым условиям работы, адаптируется, и тогда человек чувствует себя неплохо. А иногда и утверждает, что сниженный гемоглобин — это его «норма».

При снижении гемоглобина ниже 110 г/л у взрослых и детей старше 6 месяцев стоит обратиться к терапевту или педиатру. Нередко сбор анамнеза и осмотр врача резко сужают круг причин, и план дальнейших диагностических и лечебных мероприятий становится ясен уже при первом визите. В остальных случаях врач назначает ряд лабораторных и инструментальных исследований, призванных прояснить ситуацию.

Ни в коем случае не стоит самостоятельно сдавать дополнительные анализы, даже если лаборатория их заботливо объединила в комплексную услугу под названием «диагностика анемий». Вероятнее всего, полученная информация будет избыточной или недостаточной.

Как лечить анемию

Тактика лечения будет зависеть от причины, которая вызвала это состояние.

Железодефицитные анемии и анемии хронических заболеваний. Подход к лечению зависит от формы и степени тяжести железодефицитной анемии. Например, людям с начальной формой анемии — чаще всего это молодые женщины, беременные и дети — могут помочь препараты железа в таблетках, в форме сиропов или капель. Выбирать лекарство и назначать дозировку должен врач. Диетой анемия не лечится: даже из еды, богатой железом, его всасывается слишком мало для восстановления запасов.

Лечение железодефицитной анемии у взрослых — международный учебник для врачей Uptodate

Лечение анемии, связанной с хроническими заболеваниями — международный учебник для врачей Uptodate

Федеральные клинические рекомендации по диагностике и лечению железодефицитной анемии, 2015PDF, 685 КБ

У людей с внешними и внутренними кровотечениями, хроническими болезнями, воспалительными заболеваниями желудка и кишечника потери железа обычно более серьезные. Помимо лечения основного заболевания таким пациентам, как правило, назначают внутривенные препараты железа. Это позволяет быстрее восполнить запасы. А еще введенное в кровь железо могут усваивать даже пациенты с воспалительными заболеваниями желудочно-кишечного тракта.

Если препарат и дозу удалось подобрать правильно, симптомы анемии в среднем исчезают через 7—10 дней, а уровень гемоглобина приходит в норму через 6—8 недель. Лечение анемии легкой степени обычно длится 3 месяца, средней степени тяжести — 4,5 месяца, а тяжелой анемии — 6 месяцев.

Стоимость препарата железа зависит от компании-производителя, количества доз в упаковке и лекарственной формы. Как правило, инъекционные препараты обходятся дороже таблеток, а таблетки — дороже капель.

Анемии, связанные с дефицитом витаминов В12. Подход к лечению зависит от степени тяжести анемии. На начальных стадиях, если дефицит связан с недостатком витаминов в пище, может быть достаточно приема витаминов в таблетках.

Если человек может скорректировать питание, прием добавок или лекарств можно будет прекратить, как только общий анализ крови и анализ крови на витамин В12 покажут, что уровень витамина пришел в норму.

При этом веганам нужно принимать добавки с ежедневной рекомендуемой дозой витамина В12 все время, пока они придерживаются этого типа питания.

Макроцитарная анемия — международный учебник для врачей Uptodate

Федеральные клинические рекомендации по диагностике и лечению анемии, обусловленной дефицитом витамина В12, 2014PDF, 618 КБ

Лечение дефицита витамина B12 и фолиевой кислоты — учебник для врачей Uptodate

При умеренной и тяжелой анемии или если человек не способен усваивать витамин в таблетках из-за воспалительного заболевания кишечника ему, как правило, требуются препараты для подкожных или внутримышечных инъекций. Подбирать их должен врач.

Лечение при помощи инъекций витамина В12 в среднем длится 4 недели, а поддерживающая терапия — 8 месяцев. Если причину анемии устранить невозможно, пациент должен будет ежегодно проходить курс лечения из 10—15 инъекций.

Анемии, связанные с дефицитом витаминов В9. Большинству пациентов с дефицитом фолиевой кислоты достаточно принимать лекарства или добавки в таблетках: витамин В9 хорошо усваивается из таблеток даже у людей с заболеваниями кишечника. Подбирать препарат и дозировку должен врач. Лечение в среднем занимает от одного до четырех месяцев.

Какими препаратами нужно лечить В12-дефицитную и фолиеводефицитную анемию

Римма Цветнова

гематолог клиники доказательной медицины DocMed

К анемии может приводить дефицит витамина В12 и дефицит фолиевой кислоты. Эти два типа анемии очень похожи, но при дефиците витамина В12 может развиваться еще и неврологическая симптоматика.

В нашей стране классическим и доступным средством для лечения В12-дефицитной анемии является цианокобаламин — дешевые ампулы в некрасивой картонной коробочке. Многих пациентов смущает вид и цена препарата, они пытаются найти что-то «получше», и поиски их выводят на оральные спреи метилкобаламина — это одна из двух активных форм витамина В12. Метилкобаламин устраняет только часть симптомов дефицита В12, поэтому не может быть рекомендован для лечения.

Фолиевая кислота, которую назначают планирующим и уже беременным женщинам, — тот же самый препарат, который используют для лечения фолиеводефицитной анемии. В зависимости от веса, возраста и причины приема препарата меняется только доза.

Цена: 31 Р. Источник: «Асна» Цена: 36 Р. Источник: «Горздрав»

На лечение железодефицитной анемии можно потратить от 10 458 Р

Назначение Цена
Прием гематолога В среднем 4000 Р
Общий анализ крови, на уровень железа, общую железосвязывающую способность, трансферрин и ферритин От 3700 Р
Прием терапевта В среднем 2500 Р
Препарат железа 250—1400 Р

Прием гематолога

В среднем 4000 Р

Общий анализ крови, на уровень железа, общую железосвязывающую способность, трансферрин и ферритин

От 3700 Р

Прием терапевта

В среднем 2500 Р

Препарат железа

250—1400 Р

На лечение анемии, связанной с внутренним кровотечением, можно потратить от 10 900 Р

Назначение Цена
Прием гематолога В среднем 4000 Р
Общий анализ крови, на уровень железа, общую железосвязывающую способность, трансферрин и ферритин От 3700 Р
Прием терапевта В среднем 2500 Р
Анализ кала на скрытую кровь От 400 Р
Эндоскопия или рентген брюшной полости 300—500 Р
Хирургическая операция Зависит от объема вмешательства

Прием гематолога

В среднем 4000 Р

Общий анализ крови, на уровень железа, общую железосвязывающую способность, трансферрин и ферритин

От 3700 Р

Прием терапевта

В среднем 2500 Р

Анализ кала на скрытую кровь

От 400 Р

Эндоскопия или рентген брюшной полости

300—500 Р

Хирургическая операция

Зависит от объема вмешательства

На лечение анемии, связанной с хроническими заболеваниями, можно потратить от 13 540 Р

Назначение Цена
Прием гематолога В среднем 4000 Р
Общий анализ крови, на уровень железа, общую железосвязывающую способность, трансферрин и ферритин От 3700 Р
Анализ на С-реактивный белок, биохимический анализ крови, анализ мочи От 3340 Р
Прием терапевта В среднем 2500 Р
Лечение основного заболевания В зависимости от болезни

Прием гематолога

В среднем 4000 Р

Общий анализ крови, на уровень железа, общую железосвязывающую способность, трансферрин и ферритин

От 3700 Р

Анализ на С-реактивный белок, биохимический анализ крови, анализ мочи

От 3340 Р

Прием терапевта

В среднем 2500 Р

Лечение основного заболевания

В зависимости от болезни

На лечение В12-дефицитной анемии можно потратить от 11 236 Р

Назначение Цена
Прием гематолога В среднем 4000 Р
Общий анализ крови, на уровень железа, общую железосвязывающую способность, трансферрин и ферритин От 3700 Р
Прием терапевта В среднем 2500 Р
Анализ на витамин В12 От 1000 Р
Цианокобаламин в инъекциях 36 Р

Прием гематолога

В среднем 4000 Р

Общий анализ крови, на уровень железа, общую железосвязывающую способность, трансферрин и ферритин

От 3700 Р

Прием терапевта

В среднем 2500 Р

Анализ на витамин В12

От 1000 Р

Цианокобаламин в инъекциях

36 Р

На лечение фолиеводефицитной анемии можно потратить от 11 336 Р

Назначение Цена
Прием гематолога В среднем 4000 Р
Общий анализ крови, на уровень железа, общую железосвязывающую способность, трансферрин и ферритин От 3700 Р
Прием терапевта В среднем 2500 Р
Анализ на витамин В9 От 1100 Р
Фолиевая кислота для беременных 36 Р

Прием гематолога

В среднем 4000 Р

Общий анализ крови, на уровень железа, общую железосвязывающую способность, трансферрин и ферритин

От 3700 Р

Прием терапевта

В среднем 2500 Р

Анализ на витамин В9

От 1100 Р

Фолиевая кислота для беременных

36 Р

Осложнения и степени тяжести анемии

Говорить об осложнениях анемии будет неверно. Анемия сама является осложнением, связанным, например, с дефицитом железа. Осложнений осложнений не бывает — правильнее оценить степень тяжести анемии, но ее может установить только врач, там все сложно.

Профилактика анемий

Предотвратить можно только ту анемию, что связана с дефицитом питания. Это прежде всего анемии, связанные с недостатком железа и витаминов группы В.

Лучший способ такой профилактики, который подходит всем здоровым людям, — полноценное разнообразное питание, которое включает продукты растительного и животного происхождения. Людям из группы риска, которым может не хватить витаминов и железа из пищи, могут потребоваться витаминные добавки.

Например, женщинам, которые готовятся к беременности, и беременным на ранних сроках рекомендуется ежедневно принимать по 400 мкг фолиевой кислоты в виде добавки к пище. Веганам имеет смысл обсудить с врачом прием добавки с витамином В12. Некоторым девушкам, у которых недавно начались месячные, может быть полезна витаминная добавка с железом, но необходимость в ее приеме тоже стоит обсудить с врачом.

Противопоказания при анемии

Противопоказания может сформулировать только врач. Они зависят от того, какие сопутствующие болезни присутствуют у человека, поэтому обобщить противопоказания не получится. В самом обычном случае при анемии надо жить как живешь, но с лекарствами.

Можно ли делать прививку от коронавируса при анемии

Анемия не является противопоказанием для прививок вакцинами от коронавирусной болезни.

Список противопоказаний к прививке очень невелик. Прививаться нельзя людям моложе 18 лет, беременным и кормящим женщинам, а также людям с инфекционными и хроническими болезнями в фазе обострения. При этом людям с симптомами простуды и кишечной инфекции можно привиться, как только спадет температура.

Истинные противопоказания к прививке есть только у людей с очень сильной аллергической реакцией, или анафилаксией:

  1. на любые лекарства;
  2. на компоненты вакцины — один из них, полисорбат 80, есть в российском препарате «Спутник V». При этом на полиэтиленгликоль и полисорбат бывает перекрестная аллергия: если у пациента есть аллергия на одно вещество, может быть аллергия и на другое. Перед прививкой людям с аллергией на полиэтиленгликоль имеет смысл проконсультироваться с врачом-аллергологом. Скорее всего, вакцинироваться можно, но только при условии, что врач будет наблюдать за состоянием привитого человека не меньше получаса;
  3. если причину тяжелой аллергической реакции, которая случилась в прошлом, установить не удалось.

Запомнить

  1. Анемия — уменьшение массы красных кровяных клеток, или эритроцитов, в организме человека. Причин у анемии может быть много, но чаще всего это дефицит железа, витамина В12 или витамина В9, скрытое кровотечение или хроническая болезнь.
  2. Часто у анемии вообще нет симптомов. Заподозрить ее можно, если у человека гемоглобин ниже 110 г/л, бледная или желтоватая кожа, холодные руки и ноги, он быстро утомляется, у него часто кружится или болит голова, бывают аритмии и одышка.
  3. При подозрении на анемию нужно обратиться к терапевту, который может направить к профильному специалисту — врачу-гематологу.
  4. Чтобы правильно диагностировать анемию, нужно сдать много анализов. Это важно: от точности диагностики зависит эффективность лечения.
  5. Тактика лечения анемии зависит от причины, которая ее вызвала. Итоговая стоимость лечения — тоже.

Анемия — Hematology.org

Анемия является наиболее распространенным заболеванием крови, и, по данным Национального института сердца, легких и крови, от нее страдают более 3 миллионов американцев.

Роль эритроцитов в развитии анемии

Эритроциты несут гемоглобин, богатый железом белок, который присоединяется к кислороду в легких и переносит его в ткани по всему телу. Анемия возникает, когда у вас недостаточно эритроцитов или когда ваши эритроциты не функционируют должным образом.Диагноз ставится, когда анализ крови показывает значение гемоглобина менее 13,5 г/дл у мужчины или менее 12,0 г/дл у женщины. Нормальные значения для детей меняются с возрастом.

Когда у вас анемия, вашему телу не хватает кислорода, поэтому вы можете испытывать один или несколько из следующих симптомов:

  • Слабость
  • Одышка
  • Головокружение
  • Учащенное или нерегулярное сердцебиение
  • Стук или «свист» в ушах
  • Головная боль
  • Холодные руки или ноги
  • Бледная или желтая кожа
  • Боль в груди

Есть ли у меня риск развития анемии?

Многие люди подвержены риску анемии из-за неправильного питания, кишечных расстройств, хронических заболеваний, инфекций и других состояний.Наибольшему риску этого заболевания подвержены женщины во время менструации или беременные, а также люди с хроническими заболеваниями. Риск анемии увеличивается по мере взросления человека.

Если у вас есть какие-либо из следующих хронических заболеваний, у вас может быть повышенный риск развития анемии:

  • Ревматоидный артрит или другое аутоиммунное заболевание
  • Болезнь почек
  • Рак
  • Болезнь печени
  • Болезнь щитовидной железы
  • Воспалительные заболевания кишечника (болезнь Крона или язвенный колит)

Признаки и симптомы анемии легко не заметить.На самом деле, многие люди даже не осознают, что у них анемия, пока она не будет выявлена ​​в анализе крови.

Распространенные виды анемии

Железодефицитная анемия  является наиболее распространенным типом анемии. Это происходит, когда в организме не хватает железа. Дефицит железа обычно возникает из-за кровопотери, но иногда может быть вызван плохой абсорбцией железа. Беременность и роды потребляют много железа, что может привести к анемии, связанной с беременностью. Люди, перенесшие операцию обходного желудочного анастомоза для снижения веса или по другим причинам, также могут иметь дефицит железа из-за плохого всасывания.

Витаминно-дефицитная анемия  может возникнуть в результате низкого уровня витамина B12 или фолиевой кислоты (фолиевой кислоты), обычно из-за неправильного питания. Пернициозная анемия — это состояние, при котором витамин В12 не всасывается в желудочно-кишечном тракте.

Анемия и беременность y  — Узнайте о факторах риска и симптомах анемии во время беременности.

Апластическая анемия   – это редкое нарушение функции костного мозга, при котором костный мозг перестает вырабатывать достаточно клеток крови (эритроцитов, лейкоцитов и тромбоцитов).Это происходит в результате разрушения или дефицита кроветворных стволовых клеток в костном мозге, в частности, когда собственная иммунная система организма атакует стволовые клетки. Однако те немногие клетки крови, которые вырабатывает костный мозг, являются нормальными. Вирусные инфекции, ионизирующее излучение и воздействие токсичных химических веществ или лекарств также могут привести к апластической анемии.

Гемолитическая анемия    возникает, когда эритроциты разрушаются в кровотоке или в селезенке. Гемолитическая анемия может быть вызвана механическими причинами (негерметичность сердечных клапанов или аневризмы), инфекциями, аутоиммунными заболеваниями или врожденными аномалиями эритроцитов.Наследственные аномалии могут повлиять на гемоглобин или структуру или функцию эритроцитов. Примеры наследственных гемолитических анемий включают некоторые виды талассемии и низкие уровни ферментов, такие как дефицит глюкозо-6-фосфатдегидрогеназы. Лечение будет зависеть от причины.

Серповидноклеточная анемия  является наследственной гемолитической анемией, при которой белок гемоглобина является аномальным, в результате чего эритроциты становятся ригидными и блокируют кровообращение, поскольку они не могут проходить через мелкие кровеносные сосуды.

Анемия, вызванная другими заболеваниями    — Некоторые заболевания могут влиять на способность организма вырабатывать эритроциты. Например, у некоторых пациентов с заболеванием почек развивается анемия, потому что почки не вырабатывают достаточно гормона эритропоэтина, чтобы сигнализировать костному мозгу о необходимости выработки новых или большего количества эритроцитов. Химиотерапия, используемая для лечения различных видов рака, часто снижает способность организма вырабатывать новые эритроциты, и в результате такого лечения часто возникает анемия.

Как лечить анемию?

Лечение анемии зависит от ее причины.

Железодефицитная анемия почти всегда связана с кровопотерей. Если у вас железодефицитная анемия, врач может назначить анализы, чтобы определить, теряете ли вы кровь из желудка или кишечника. Другие алиментарные анемии, такие как дефицит фолиевой кислоты или B-12, могут быть результатом неправильного питания или неспособности всасывать витамины в желудочно-кишечном тракте. Лечение варьируется от изменения диеты до приема пищевых добавок.

Если ваша анемия вызвана хроническим заболеванием, лечение основного заболевания часто улучшает анемию.В некоторых случаях, например при хроническом заболевании почек, врач может назначить лекарства, такие как инъекции эритропоэтина, чтобы стимулировать костный мозг к выработке большего количества эритроцитов.

Апластическая анемия возникает, если ваш костный мозг перестает вырабатывать эритроциты. Апластическая анемия может быть вызвана первичной недостаточностью костного мозга, миелодисплазией (состоянием, при котором костный мозг вырабатывает аномальные эритроциты, которые не созревают должным образом) или иногда побочным эффектом некоторых лекарств.Если у вас есть подозрение на апластическую анемию, врач может направить вас к гематологу для биопсии костного мозга, чтобы определить причину анемии. Лекарства и переливания крови могут быть использованы для лечения апластической анемии.

Гемолитическая анемия возникает при разрушении эритроцитов в кровотоке. Это может быть связано с механическими факторами (негерметичность клапана сердца или аневризма), инфекцией или аутоиммунным заболеванием. Причину часто можно определить с помощью специальных анализов крови и осмотра эритроцитов под микроскопом.Лечение будет зависеть от причины и может включать направление к специалисту по сердечным или сосудистым заболеваниям, прием антибиотиков или препаратов, подавляющих иммунную систему.

Поговорите со своим врачом, если вы считаете, что у вас может быть риск развития анемии. Ваш врач определит наилучший курс лечения и, в зависимости от вашего состояния, может направить вас к гематологу, врачу, специализирующемуся на заболеваниях крови.

Можно ли предотвратить анемию?

Хотя многие виды анемии невозможно предотвратить, употребление здоровой пищи может помочь вам избежать как железодефицитной, так и витаминодефицитной анемии.Продукты, которые следует включить в свой рацион, включают продукты с высоким содержанием железа (говядина, темно-зеленые листовые овощи, сухофрукты и орехи), витамина B-12 (мясо и молочные продукты) и фолиевой кислоты (цитрусовые соки, темно-зеленые листовые овощи, бобовые и обогащенные злаки). Ежедневный прием поливитаминов также поможет предотвратить алиментарную анемию; тем не менее, пожилые люди не должны принимать железосодержащие добавки при железодефицитной анемии, если это не рекомендовано их врачами.

Наследственный сфероцитоз: путешествие пациента

Где я могу найти дополнительную информацию?

Если вы обнаружите, что вам интересно узнать больше о заболеваниях и расстройствах крови, вот несколько других ресурсов, которые могут вам помочь:

Результаты клинических исследований, опубликованные в 
Кровь

Поиск  Blood , официальный журнал ASH, для получения результатов последних исследований крови.Хотя последние статьи обычно требуют входа в систему подписчика, пациенты, заинтересованные в просмотре статьи с контролируемым доступом в Blood , могут получить копию, отправив запрос по электронной почте в издательство Blood  Publishing Office.

Группы пациентов

Список веб-ссылок на группы пациентов и другие организации, предоставляющие информацию.

Анемия Фанкони: MedlinePlus Genetics

Анемия Фанкони — это состояние, поражающее многие части тела. У людей с этим заболеванием может быть недостаточность костного мозга, физические отклонения, дефекты органов и повышенный риск некоторых видов рака.

Основной функцией костного мозга является производство новых клеток крови. К ним относятся эритроциты, которые переносят кислород к тканям организма; лейкоциты, которые борются с инфекциями; и тромбоциты, необходимые для нормального свертывания крови. Примерно у 90 процентов людей с анемией Фанкони нарушена функция костного мозга, что приводит к снижению выработки всех клеток крови (апластическая анемия). Больные испытывают крайнюю усталость (усталость) из-за низкого количества эритроцитов (анемия), частые инфекции из-за низкого количества лейкоцитов (нейтропения) и проблемы со свертываемостью крови из-за низкого количества тромбоцитов (тромбоцитопения). У людей с анемией Фанкони также может развиться миелодиспластический синдром — состояние, при котором незрелые клетки крови не могут нормально развиваться.

Более половины людей с анемией Фанкони имеют физические отклонения. Эти аномалии могут включать неравномерную окраску кожи, такую ​​как необычно светлая кожа (гипопигментация) или пятна цвета кофе с молоком, которые представляют собой плоские пятна на коже, которые темнее окружающей области. Другие возможные симптомы анемии Фанкони включают деформацию больших пальцев или предплечий и другие проблемы со скелетом, включая низкий рост; неправильно сформированные или отсутствующие почки и другие дефекты мочевыводящих путей; желудочно-кишечные аномалии; пороки сердца; аномалии глаз, такие как маленькие глаза или глаза неправильной формы; и деформированные уши и потеря слуха.Люди с этим заболеванием могут иметь аномальные гениталии или пороки развития репродуктивной системы. В результате большинство больных мужчин и около половины больных женщин не могут иметь биологических детей (бесплодны). Дополнительные признаки и симптомы могут включать аномалии головного и спинного мозга (центральной нервной системы), в том числе повышенное содержание жидкости в центре головного мозга (гидроцефалия) или необычно маленький размер головы (микроцефалия).

Лица с анемией Фанкони имеют повышенный риск развития рака кроветворных клеток костного мозга, называемого острым миелоидным лейкозом (ОМЛ), или опухолей головы, шеи, кожи, желудочно-кишечного тракта или половых путей.Вероятность развития одного из этих видов рака у людей с анемией Фанкони составляет от 10 до 30 процентов.

Что такое серповидноклеточная анемия?

ВСС представляет собой группу наследственных заболеваний эритроцитов. Здоровые эритроциты имеют круглую форму и перемещаются по мелким кровеносным сосудам, доставляя кислород ко всем частям тела. У человека с ВСС эритроциты становятся твердыми и липкими и напоминают С-образный сельскохозяйственный инструмент, называемый «серпом». Серповидные клетки рано погибают, что вызывает постоянную нехватку эритроцитов. Кроме того, когда они проходят через мелкие кровеносные сосуды, они застревают и блокируют кровоток. Это может вызвать боль и другие серьезные проблемы, такие как инфекция, острый грудной синдром и инсульт.

Типы SCD

Ниже приведены наиболее распространенные типы SCD:

HbSS

Люди с этой формой ВСС наследуют два гена серповидно-клеточной анемии («S»), по одному от каждого родителя. Это обычно называют серповидно-клеточной анемией и обычно это самая тяжелая форма заболевания.

HbSC

Люди с этой формой ВСС наследуют ген серповидно-клеточной анемии («S») от одного родителя, а от другого родителя — ген аномального гемоглобина, называемый «С». Гемоглобин — это белок, который позволяет эритроцитам переносить кислород ко всем частям тела. Обычно это более легкая форма ВСС.

HbS-бета-талассемия

Люди с этой формой ВСС наследуют один ген серповидно-клеточной анемии («S») от одного родителя и один ген бета-талассемии, другого типа анемии, от другого родителя. Различают два типа бета-талассемии: «0» и «+». Те, у кого HbS бета-талассемия, обычно имеют тяжелую форму ВСС. Люди с HbS бета +-талассемией, как правило, имеют более легкую форму ВСС.

Также есть несколько редких типов SCD:

HbSD, HbSE и HbSO

Люди с этими формами ВСС наследуют один ген серповидно-клеточной анемии («S») и один ген аномального типа гемоглобина («D», «E» или «O»). Гемоглобин — это белок, который позволяет эритроцитам переносить кислород ко всем частям тела.Тяжесть этих более редких типов ВСС варьируется.

Признак серповидноклеточной анемии (SCT)

ХБАС

Люди с SCT наследуют один ген серповидно-клеточной анемии («S») от одного родителя и один нормальный ген («A») от другого родителя. Это называется серповидноклеточным признаком (SCT). Люди с SCT обычно не имеют каких-либо признаков заболевания и живут нормальной жизнью, но они могут передать эту черту своим детям. Кроме того, есть несколько необычных проблем со здоровьем, которые потенциально могут быть связаны с чертой серповидно-клеточной анемии.

Узнайте больше о признаке серповидно-клеточной анемии »

Причина ВСС

ВСС представляет собой генетическое заболевание, присутствующее при рождении. Он передается по наследству, когда ребенок получает два гена серповидно-клеточной анемии — по одному от каждого родителя.

Диагностика

SCD диагностируется с помощью простого анализа крови. Чаще всего его обнаруживают при рождении во время рутинных скрининговых тестов новорожденных в больнице. Кроме того, ВСС можно диагностировать еще до рождения.

Поскольку дети с ВСС подвержены повышенному риску заражения и других проблем со здоровьем, важны ранняя диагностика и лечение.

Вы можете позвонить в местную организацию серповидно-клеточной анемии, чтобы узнать, как пройти тестирование.

Осложнения и лечение

У людей с ВСС первые признаки заболевания появляются в течение первого года жизни, обычно в возрасте около 5 месяцев. Симптомы и осложнения ВСС различны для каждого человека и могут варьироваться от легких до тяжелых.

Не существует единственного наилучшего лечения для всех людей с ВСС. Варианты лечения различны для каждого человека в зависимости от симптомов.

Узнайте об осложнениях и лечении »

Лечение

Единственным лекарством от ВСС является трансплантация костного мозга или стволовых клеток.

Костный мозг представляет собой мягкую жировую ткань в центре костей, где образуются клетки крови. Трансплантация костного мозга или стволовых клеток — это процедура, при которой здоровые клетки, образующие кровь, берутся у одного человека — донора — и пересаживаются человеку, чей костный мозг не работает должным образом.

Трансплантация костного мозга или стволовых клеток очень рискованна и может иметь серьезные побочные эффекты, включая смерть.Чтобы трансплантат сработал, костный мозг должен быть близким. Обычно лучшим донором является брат или сестра. Трансплантация костного мозга или стволовых клеток используется только в случаях тяжелой ВСС у детей с минимальным поражением органов от заболевания.

Обучение — это надежда | Международный фонд апластической анемии и МДС

Международный фонд Апластической анемии и МДС является ведущей в мире некоммерческой организацией здравоохранения, занимающейся поддержкой пациентов и семей, живущих с апластической анемией, миелодиспластическим синдромом (МДС), заболеваний костного мозга .Фонд дает ответы, поддержку и надежду тысячам пациентов и их семьям по всему миру.

Мы являемся организацией, ориентированной на пациента, ориентированной на пациента, которая обслуживает пациентов и их семьи на протяжении трех стадий заболеваний костного мозга:

  • жизненно важный этап диагностики
  • опасная для жизни фаза лечения
  • пожизненная фаза жизни с хроническим заболеванием

Myriad Women’s Health

Что такое анемия Фанкони, комплементарная группа А?

Анемия Фанкони — это группа наследственных заболеваний, при которых организм не может должным образом вырабатывать белок, защищающий ДНК от повреждения. Дефектный белок приводит к нарушению способности костного мозга производить все типы клеток крови. Без достаточного количества эритроцитов организм не получает достаточного количества кислорода, что может привести к аномалиям костей и органов, а также к задержке развития. Точно так же нехватка лейкоцитов делает организм более восприимчивым к инфекциям и раку, а снижение количества тромбоцитов затрудняет свертывание крови при травме.

Лица с анемией Фанкони обычно рождаются с какими-либо физическими отклонениями, наиболее распространенными из которых являются низкий рост, пороки развития большого или указательного пальца, изменение цвета кожи, аномалии почек и глаз, а также аномалии скелета.Однако от 25 до 40% людей с этим заболеванием не имеют физических отклонений. Таким образом, у людей в детстве может быть впервые диагностирован аномально низкий уровень эритроцитов, лейкоцитов или тромбоцитов, вызванный недостаточностью костного мозга (поскольку это прогрессирует, у большинства людей будут некоторые осложнения, связанные с кровью), потеря слуха (10% особей), некоторая степень задержки развития (10% особей) и/или рак.

Риск рака выше среднего связан с неспособностью клеток восстанавливать себя при повреждении ДНК.Иногда начальные признаки лейкемии проявляются в детском возрасте как первый симптом заболевания. Другие виды рака также могут появиться в необычно раннем возрасте, особенно опухоли головы и шеи, пищевода, шейки матки, вульвы (внешнего отверстия влагалища) или печени.

Насколько распространена анемия Фанкони, комплементарная группа А?

Анемия Фанкони типа А является наиболее распространенным типом анемии Фанкони, составляющим от 60 до 70% всех случаев и поражающим примерно 1 из 200 000 человек.Однако частота заболевания и количество случаев, приписываемых FANCA , различаются в определенных этнических группах из-за эффектов основателя (высокая частота заболевания, поскольку группа возникла из небольшой, возможно, изолированной популяции). Эффекты основателя были отмечены у лиц сефардского еврейского происхождения (марокканцев и индийцев), тунисского происхождения, африканеров, бразильцев, испанских цыган и других.

Как лечить анемию Фанкони, комплементарную группу А?

В настоящее время нет лекарства от анемии Фанкони типа А.Лечение заключается в наблюдении за симптомами и лечении их по мере их появления.

Примерно половина всех людей с этим заболеванием может улучшить количество клеток крови с помощью лекарств. Однако в течение нескольких лет у людей часто развивается устойчивость к лекарству. Медикаментозное лечение также может снизить эффективность последующей трансплантации костного мозга.

Трансплантация костного мозга может вылечить лейкемию, связанную с анемией Фанкони типа А. Однако люди с этим заболеванием чрезвычайно чувствительны к химиотерапии и лучевой терапии, необходимой для подготовки к трансплантации, поэтому они не могут быть хорошими кандидатами на эту операцию.Трансплантация костного мозга не предотвращает солидные опухоли в других частях тела, которые необходимо лечить с помощью химиотерапии и облучения.

Люди с анемией Фанкони типа А должны регулярно проходить анализы крови, биопсию костного мозга, сканирование печени, а также гинекологические, стоматологические и ректальные обследования для выявления рака на ранней стадии, чтобы их можно было удалить как можно скорее.

Каков прогноз для человека с комплементарной группой А анемии Фанкони?

Прогноз для человека с заболеванием зависит от тяжести симптомов, которые будут варьироваться от человека к человеку.

Анемия — familydoctor.org

Что вызывает анемию?

Существуют три основные причины возникновения анемии.

  1. Ваше тело не может производить достаточно эритроцитов.

Неспособность производить достаточное количество эритроцитов может быть вызвано несколькими причинами, включая диету, беременность, болезни и многое другое.

Диета

Ваше тело может не производить достаточное количество эритроцитов, если вам не хватает определенных питательных веществ. Низкий уровень железа является распространенной проблемой.Люди, которые не едят мясо или придерживаются «причудливых» диет, более подвержены риску низкого уровня железа. Младенцы и дети младшего возраста подвержены риску развития анемии из-за диеты с низким содержанием железа. Недостаток витамина B12 и фолиевой кислоты также может вызвать анемию.

Трудность поглощения

Некоторые заболевания влияют на способность тонкой кишки усваивать питательные вещества. Например, болезнь Крона и глютеновая болезнь могут вызвать низкий уровень железа в организме. Некоторые продукты, например молоко, могут препятствовать усвоению железа организмом.В этом может помочь прием витамина С. Лекарства, такие как антациды или рецепты для снижения кислоты в желудке, также могут повлиять на это.

Беременность

Беременные или кормящие грудью люди могут заболеть анемией. Когда вы беременны, вам нужно больше крови (до 30 %), чтобы поделиться ею с ребенком. Если вашему телу не хватает железа или витамина B12, оно не может производить достаточно эритроцитов.

Следующие факторы могут увеличить риск анемии во время беременности:

  • Сильная рвота из-за утренней тошноты
  • Диета с низким содержанием питательных веществ
  • Обильные менструации до беременности
  • Наличие двух беременностей одновременно
  • Беременность сразу несколькими детьми
  • Забеременеть в подростковом возрасте
  • Потеря большого количества крови в результате травмы или операции

Скачки роста

Дети в возрасте до 3 лет склонны к анемии. Их тела растут так быстро, что им трудно получать или сохранять достаточное количество железа.

Нормоцитарная анемия

Нормоцитарная анемия может быть врожденной (от рождения) или приобретенной (в результате болезни или инфекции). Наиболее частой причиной приобретенной формы является хроническое (длительное) заболевание. Примеры включают заболевание почек, рак, ревматоидный артрит и тиреоидит. Некоторые лекарства могут вызывать нормоцитарную анемию, но это бывает редко.

  1. Ваше тело разрушает эритроциты раньше и быстрее, чем их можно заменить.

Лечение, такое как химиотерапия, может повредить эритроциты и/или костный мозг. Инфекция, вызванная ослабленной иммунной системой, может привести к анемии. Вы можете родиться с заболеванием, которое разрушает или удаляет эритроциты. Примеры включают серповидно-клеточную анемию, талассемию и недостаток определенных ферментов. Наличие увеличенной или больной селезенки также может вызвать анемию.

  1. У вас кровопотеря, которая создает нехватку эритроцитов.

Обильные менструации могут вызывать низкий уровень железа у женщин.Внутреннее кровотечение, например, из пищеварительного тракта или мочевыводящих путей, может вызвать потерю крови. Это может быть вызвано такими состояниями, как язва желудка или язвенный колит. Другие причины кровопотери включают:

  • Рак
  • Хирургия
  • Травма
  • Прием аспирина или аналогичного лекарства в течение длительного времени

Белок группы А анемии Фанкони модулирует гомологичную репарацию двухцепочечных разрывов ДНК в клетках млекопитающих | Канцерогенез

Аннотация

Клетки анемии Фанкони (FA) проявляют гиперчувствительность к межцепочечным поперечным связям ДНК (ICL) и высокий уровень хромосомной нестабильности.Было показано, что продукты гена FA функционально или физически взаимодействуют с BRCA1, RAD51 и комплексом MRE11/RAD50/NBS1, что позволяет предположить, что комплекс FA может участвовать в репарации двухцепочечных разрывов ДНК (DSB). Здесь мы специально исследовали функцию белка FA группы A (FANCA) в восстановлении DSB в клетках млекопитающих. Мы показываем, что целенаправленная делеция экзонов 37–39 Fanca приводит к нулевому состоянию Fanca у мышей и отменяет убиквитинирование Fancd2, нижестоящего эффектора комплекса FA.Клетки, лишенные Fanca, обнаруживают повышенные хромосомные аберрации и ослабленное накопление фокусов Brca1 и Rad51 в ответ на повреждение ДНК. Отсутствие Fanca значительно снижает эффективность нацеливания на гены в эмбриональных стволовых (ES) клетках мыши и ставит под угрозу выживание клеток фибробластов в ответ на лечение агентом ICL. Fanca -null клетки демонстрируют нарушенную гомологически направленную репарацию (HDR) DSB, особенно влияющую на путь одноцепочечного отжига. Эти данные идентифицируют белок Fanca как неотъемлемый компонент на ранней стадии HDR DSB и, таким образом, сводя к минимуму геномную нестабильность.

DSB, двухцепочечный разрыв, ES, эмбриональный стебель, FA, анемия Фанкони, HDR, гомологичная репарация, ICL, межцепочечные сшивки, LTGC, конверсия длинных путей гена, MMC, митомицин C, NHEJ, негомологичное соединение концов , SSA, одноцепочечный отжиг, STGC, конверсия генов с коротким трактом

Введение

Анемия Фанкони (ФА) представляет собой генетически гетерогенное заболевание, характеризующееся поражением костного мозга, врожденными аномалиями и повышенной заболеваемостью раком (1, 2). Клетки пациентов с ФА проявляют гиперчувствительность к бифункциональным сшивающим агентам, таким как митомицин С (ММС), и повышенную частоту спонтанных хромосомных разрывов и транслокаций, которая еще больше увеличивается после воздействия ММС (3, 4). Клеточный дефект, ответственный за FA, вызван мутацией любого из 11 генов, определяемых группами комплементации, от FA-A до FA-L , установленными путем гибридизации соматических клеток клеток пациента. Девять из генов FA были идентифицированы: Fanca , Fancb , Fancc , Fancd1 / Brca2 , Fancd2 , Fance , Fancf , Fancg и Fancl (2, 5 , 6).

MMC индуцирует межцепочечные поперечные связи ДНК (ICL), которые приводят к двухцепочечным разрывам ДНК (DSB) во время репликации ДНК (7–9). Гиперчувствительность FA-клеток к агентам ICL может быть связана с дефектами в гомологически направленной репарации (HDR) DSB. Человеческие фибробласты FA также проявляют гиперчувствительность к индуцированным ферментами рестрикции DSB хромосомной ДНК (10). Кроме того, некоторые пациенты с ФА и клетки проявляют легкую радиочувствительность, что может отражать небольшую долю радиационно-индуцированных DSB, которые восстанавливаются с помощью HDR (11).Биохимические исследования показали, что белки FA, FANCA, FANCB, FANCC, FANCE, FANCF, FANCG и FANCL образуют мультисубъединичный ядерный комплекс (6, 12). Моноубиквитинирование FANCD2 с помощью FANCL (убиквитинлигаза E3) нарушено в клетках, в которых отсутствует какой-либо член вышестоящего корового комплекса FA (12, 13), что объясняет их общую гиперчувствительность к агентам, сшивающим ДНК.

Было показано, что FANCD1/BRCA2 участвует в HDR DSB, предположительно посредством физического взаимодействия с RAD51 (14-16).Описаны прямые взаимодействия между FANCA и BRCA1, FANCG и FANCD1/BRCA2, а также между FANCD2 и FANCD1/BRCA2 (17–20). После моноубиквитинирования FANCD2 взаимодействует с NBS1 и колокализуется с RAD51 и BRCA1 в ядерных очагах в ответ на повреждение ДНК (13, 21, 22), и считается, что это необходимо для его функции в репарации DSB ДНК. Следовательно, ожидается, что белки FA репарируют DSB, генерируемые, когда механизм репликации сталкивается с ICL. Однако точный путь, используемый белками FA при репарации DSB, остается неясным.

Недавние исследования показали, что инактивация гомологов FANCG , FANCC или FANCD2 в клетках DT40, полученных из В-лимфомы цыпленка, приводит к недостаточной гомологичной репарации, что подтверждает эту гипотезу (23-25). Однако, поскольку FANCG человека имеет только 39% идентичность куриному гомологу и неспособна комплементировать куриные клетки, лишенные Fancg , релевантность результатов этой системы для комплекса FA млекопитающих остается в значительной степени неизвестной.Наконец, группа ФА А составляет более 60% от общего числа пациентов с ФА, а функция белка (FANCA) в процессе репарации ДНК не изучалась ни в системе млекопитающих, ни в клетках цыплят. Несмотря на большие усилия, точные молекулярные пути, с помощью которых FANCA участвует в репарации DSB in vivo , не установлены.

Чтобы найти прямые доказательства участия белков FA в восстановлении DSB в клетках млекопитающих, мы сконструировали мышиные клетки, не содержащие белка Fanca, и проанализировали пути восстановления DSB.Мыши с нокаутом Fanca и клетки с определенным генетическим фоном представляют собой мощный инструмент для исследования аутентичных функций Fanca при репарации DSB. Мы показываем, что Fanca непосредственно участвует в репарации DSB ДНК, способствуя как HDR, так и, в частности, пути одноцепочечного отжига (SSA). Ожидается, что неспособность активировать репарацию DSB соответствующими путями приведет к более широкому использованию альтернативных, подверженных ошибкам процессов репарации, что объясняет фенотип хромосомной нестабильности у пациентов с FA.

Материалы и методы

Нацеливание на гены и клеточные линии

Вектор-мишень pTVFlox- Fanca был сконструирован путем клонирования ПЦР-амплифицированных геномных фрагментов FA в вектор pTVFlox. Один сайт lox-P был вставлен в интрон 39, а два сайта lox-P, фланкирующие ген устойчивости к неомицину ( neo ), были введены в интрон 36. Ген тимидинкиназы ( tk ) использовали для негативной селекции. Линеаризованный нацеливающий вектор электропорировали в Е14.1 эмбриональные стволовые (ES) клетки и клоны-мишени ES ( Fanca +/t ) идентифицировали с помощью ПЦР и Саузерн-блоттинга. Для получения делеционного аллеля Fanca клоны Fanca +/t ES временно трансфицировали Cre-экспрессирующей плазмидой pMC-Cre, а клоны Fanca +/Δ идентифицировали с помощью ПЦР и Саузерн-блоттинга. . Для удаления оставшегося аллеля дикого типа Fanca два независимых клона Fanca +/Δ ES подвергали электропорации с pTVFlox- Fanca и затем с pMC-Cre. Fanca Δ/Δ Клоны идентифицировали Саузерн-блоттингом и Вестерн-блоттингом. Кожные фибробласты были получены из биоптатов ушей мышей Fanca +/+ и Fanca Δ/Δ и иммортализованы с помощью трансфекции вектора pPrSty, экспрессирующего большой Т-антиген SV40, как описано ранее (26). ).

Конструирование стабильных клеточных линий и анализ рекомбинации

линии клеток ES, содержащие одну интактную копию репортерного субстрата DRGFP в локусе hprt , и клеточные линии фибробластов, в которых субстрат интегрирован в случайном локусе, были сконструированы, как описано ранее (27-29).Плазмиду pCBASce, экспрессирующую эндонуклеазу I- Sce I, и макет вектора pCAGGS (без гена I- Sce I) электропорировали в клетки для анализа рекомбинации и в контрольные клетки соответственно. Проточный цитометрический анализ проводили, как описано ранее (28).

Физический анализ ремонта ДЦБ

Фрагмент ДНК, окружающий исходное местоположение сайта I- Sce I, амплифицировали с помощью ПЦР из генома ложных или I- Sce I-трансфицированных клеток, как описано ранее (28).Путь репарации DSB через HDR, такой как генная конверсия короткого пути (STGC), SSA, генная конверсия длинного пути (LTGC) или негомологичное соединение концов (NHEJ), измеряли по плотности полос ДНК после окрашивания бромид этидия, как описано ранее (28). События STGC, SSA или LTGC, измеренные с помощью увеличения сайта Bcg I, аналогичны событиям, полученным путем прямого секвенирования устойчивых фрагментов I- Sce I, как описано ранее (28). Чтобы исследовать путь SSA, мы использовали комбинированный метод ПЦР-Саузерн-блоттинга.После экспрессии I- Sce I геномную ДНК использовали в качестве ПЦР-матрицы для двух пар праймеров для ПЦР, либо SA-F и SA-R1, либо SA-F и SA-R2 (SA-F: GCAACGTGCTGGTTATTGTG; SA-R1). CAAATGTGGTATGGCTGATTATG; SA-R2 ATGACCATGATTACGCCAAG). Амплификация проводилась в течение 20 циклов, что было определено как находящееся в линейном диапазоне. Саузерн-блоты продуктов ПЦР зондировали с помощью 32 P-меченого фрагмента из DR GFP, который разрезали с помощью Hind III/ Bam HI.

Анализ выживания колоний

Клетки

фибробластов высевали в двух экземплярах в культуральной чашке 250 клеток/10 см и добавляли MMC (Sigma, Сент-Луис, Миссури, США) в различных концентрациях. Через 10 дней роста клетки в чашках фиксировали в метаноле/уксусной кислоте и окрашивали по Гимзе. Колонии на чашку подсчитывали и выражали в процентах от необработанных контролей.

Хромосомный анализ

Фибробласты высевали в чашки для культивирования диаметром 10 см и собирали через 2 дня в логарифмической фазе. Митомицин С добавляли до конечной концентрации 40 или 80 нг/мл за 24 часа до сбора урожая. Митотические клетки в среде над монослоями добавляли обратно к трипсинизированным адгезивным клеткам перед инкубацией в гипотоническом растворе KCl (0.4%). Поломку хромосом оценивали вслепую с помощью кодированных слайдов. Были подсчитаны хроматидные разрывы и числа транслокаций, а также хромосомные аберрации, включая кольцевые хромосомы, изохроматидные разрывы и дицентрические хромосомы. Хромосомные транслокации и слияния считали за два разрыва, хроматидные разрывы – за один.

Вестерн-блоттинг и иммунопреципитация

Белки (50 мкг), экстрагированные из клеток в буфере RIPA, разделяли с помощью 8% SDS-PAGE и подвергали электроблотингу на нитроцеллюлозные мембраны. Для зондирования блотов использовали следующие антитела: сыворотку морской свинки против Fanca (1:200) и сыворотку кролика против Fanca (1:3000) [оба антитела были индуцированы против аминокислот 1–454 белка Fanca; любезно предоставлено доктором Фре Арвертом; (30)] и антиактиновую сыворотку мыши (1:5000; Санта-Крус, Калифорния, США). Хемилюминесцентное обнаружение проводили с использованием реагента ECL (Amersham Pharmacia Biotech, Фрайбург, Германия). Для иммунопреципитации 800 мкг цельноклеточного лизата инкубировали с 50 мкл кроличьей сыворотки анти-Fanca, и белки, связанные с антителами, собирали путем инкубации в течение 16 ч с магнитными шариками, конъюгированными с овечьим антикроличьим IgG (Dynal Biotech GmbH, Гамбург, Германия). ).

Обнаружение моноубиквитинированного Fancd2

Клетки обрабатывали или не обрабатывали 50 нг/мл ММС или 5 мМ гидроксимочевины в течение 24 часов. Белки (80 мкг), экстрагированные из клеток в буфере для лизиса (1% TritonX-100, 0,1% SDS, 0,25% DOC, 1 мМ ЭДТА, 50 мМ NaF и ингибиторы протеиназ), разделяли с помощью 6% SDS-PAGE и подвергали электроблотингу на нитроцеллюлозу. мембрана. Для обнаружения убиквитинированного Fancd2 использовали антитело E35 против FANCD2 [любезно предоставленное доктором Аланом Д.Д’Андреа; ( 13 )].

Иммунофлуоресцентное окрашивание для формирования очагов

Клетки, выращенные на покровных стеклах, обрабатывали 100 нг/мл ММС в течение 1 ч, фиксировали в указанные моменты времени ледяным метанолом в течение 15 мин и пермеабилизировали ледяным ацетоном в течение 2 мин. Клетки окрашивали кроличьими поликлональными антителами против Rad51 (1:200, Oncogene, Cambridge, MA, USA) или мышиными моноклональными антителами против Brca1 (1:10, любезно предоставлены доктором Дэвидом М. Ливингстоном). Предметные стекла помещали в монтажную среду Vectashield с DAPI (Vector Laboratories, Burlingame, CA, USA) и визуализировали под флуоресцентным микроскопом Zeiss Axioskop, оснащенным системой визуализации CCD (IP Lab Spectrum, NY, USA).Для каждого образца подсчитывали не менее 300 ядер. Клетка с не менее чем пятью различными очагами в ядре оценивалась как очаг-положительная клетка.

Результаты

Получение и характеристика эмбриональных стволовых клеток и фибробластов Fanca-null мышей

До сих пор сообщалось о нескольких мутантных линиях мышей Fanca , которые несут гомозиготную мутацию зародышевой линии Fanca (31-33). В то время как делеция экзонов 4-7 делала мышей бесплодными (31), мыши с делецией экзонов 1-6 демонстрировали различные симптомы FA, некоторые из которых зависели от генетического фона (33).Кроме того, мыши с делецией экзона 37 проявляли некоторые клеточные фенотипы, имитирующие FA, хотя эта стратегия приводила к «дырявой» делеции Fanca (32). Поскольку внутригенные делеции в районе экзонов 37–39 часто выявляют у пациентов с ФА, мы поставили задачу исследовать возможное влияние мутаций в С-конце Fanca. С этой целью мы создали новые линии мышей, несущие ген Fanca , нарушенный в этой области. Для получения Fanca нулевых мышиных ЭС и клеток фибробластов мы сконструировали нацеливающий вектор pTVFlox- Fanca , вставив кассету гена неомицина ( neo ), окруженную двумя сайтами loxP, в интрон 36 и поместив третий сайт loxP в интрон 36. интрон 39 (рис. 1А).Мы получили клонов Fanca +/Δ ES (несущих делецию экзонов 37–39) после транзиентной трансфекции Cre-экспрессирующей плазмидой в целевые ( Fanca +/ t ) клоны ES, которые были созданы нацеливание генов с использованием вектора нацеливания pTVFlox- Fanca в клетках E14.1 ES (фиг. 1B). Чтобы разрушить оставшийся аллель дикого типа клеток Fanca +/Δ , мы создали клоны Fanca t/Δ ES путем электропорации того же нацеливающего вектора в клетки Fanca +/Δ .После трансфекции Cre-экспрессирующей конструкцией в два независимых клона Fanca t/Δ ES пять гомозиготных клонов Fanca Δ/Δ ES идентифицировали Саузерн-блоттингом (фиг. 1B). Вестерн-блот-анализ с использованием антител, выработанных против аминокислот 1–454 белка Fanca, не обнаружил белка в этих клонах ES (рис. 1C), что указывает на делецию экзонов 37–39 Fanca в наших нокаутных клетках и мышах. является нулевой мутацией.

Рис. 1.

Направленное разрушение мышиного гена Fanca в клетках ЭС и фибробластах. ( A ) Структура нацеливающего вектора и карта частичной рестрикции локуса Fanca . Показаны локус Fanca до и после гомологичной рекомбинации и Cre-опосредованной рекомбинации. Экзоны обозначены черными прямоугольниками, а числа ниже указывают номер экзона. Сайты LoxP представлены пустыми треугольниками.Положение внешнего зонда 5′ (P) представлено пустым прямоугольником. S, Sac I. ( B ) Саузерн-блоттинг Fanca мутантных клонов ES после расщепления геномной ДНК с помощью Sac I с получением полосы дикого типа размером 3 т.п.н., полосы целевого аллеля размером 4,2 т.п.н. и полоса удаленных аллелей размером 9 т.п.н. Различные аллели Fanca обозначены следующим образом: дикий тип (+/+ или wt), целевой (t) и удаленный (Δ). ( C ) Вестерн-блот анализ уровней белка Fanca в клонах дикого типа (+/+) (W1, W2) и Fanca Δ/Δ ES (h2, C8). Актин – это контроль загрузки. ( D ) Вестерн-блот анализ уровней белка Fanca в Fanca Δ/Δ (Δ/Δ) и клетках фибробластов дикого типа (+/+). Левая колонка и правая колонка показывают общий лизат клеток и продукты иммунопреципитации соответственно. Молекулярная масса указана в средней колонке. Актин использовали для контроля нагрузки.

Рис. 1.

Направленное разрушение мышиного гена Fanca в клетках ЭС и фибробластов.( A ) Структура нацеливающего вектора и карта частичной рестрикции локуса Fanca . Показаны локус Fanca до и после гомологичной рекомбинации и Cre-опосредованной рекомбинации. Экзоны обозначены черными прямоугольниками, а числа ниже указывают номер экзона. Сайты LoxP представлены пустыми треугольниками. Положение внешнего зонда 5′ (P) представлено пустым прямоугольником. S, Sac I. ( B ) Саузерн-блоттинг Fanca мутантных клонов ES после расщепления геномной ДНК с помощью Sac I с получением полосы дикого типа размером 3 т. п.н., a 4.Полоса целевого аллеля размером 2 т.п.н. и полоса удаленного аллеля размером 9 т.п.н. Различные аллели Fanca обозначены следующим образом: дикий тип (+/+ или wt), целевой (t) и удаленный (Δ). ( C ) Вестерн-блот анализ уровней белка Fanca в клонах дикого типа (+/+) (W1, W2) и Fanca Δ/Δ ES (h2, C8). Актин – это контроль загрузки. ( D ) Вестерн-блот анализ уровней белка Fanca в Fanca Δ/Δ (Δ/Δ) и клетках фибробластов дикого типа (+/+).Левая колонка и правая колонка показывают общий лизат клеток и продукты иммунопреципитации соответственно. Молекулярная масса указана в средней колонке. Актин использовали для контроля нагрузки.

Чтобы изучить роль Fanca в репарации DSB, мы создали мышей и клетки с дефицитом Fanca, используя два клона Fanca +/Δ ES, которые были микроинъецированы в бластоцисты для получения химерных мышей зародышевой линии. Мыши Fanca Δ/Δ были получены при нормальном менделевском соотношении после скрещивания мышей Fanca +/Δ (M. Digweed и Z.-Q.Wang, неопубликованные данные). Для проведения следующих исследований мы выделили клетки ушных фибробластов у мышей дикого типа и Fanca Δ/Δ мышей. Фибробласты Fanca Δ/Δ не содержали белка Fanca, что было определено вестерн-блоттингом и иммунопреципитацией (рис. 1D).

Нарушенная реакция на повреждение ДНК и повышенная нестабильность хромосом в Fanca-нулевых клетках

Чтобы проверить биологические последствия делеции Fanca, мы провели анализ выживаемости колоний с использованием Fanca нулевых мутантных фибробластов.Клетки фибробластов высевали в чашки для культивирования 250 клеток/10 см и обрабатывали различными дозами ММС. После 10 дней роста мы обнаружили, что количество колоний клеток Fanca Δ/Δ значительно уменьшилось по сравнению с контрольными клетками дикого типа (рис. 2А). Поскольку нестабильность хромосом является отличительной чертой FA-лимфоцитов и фибробластов (34, 35), мы затем исследовали, используя мышиные Fanca -null клетки, инструментальную роль дефицита Fanca в хромосомных аберрациях. Мы обнаружили очень большое увеличение спонтанных хроматидных разрывов, транслокаций и других хромосомных аберраций в клетках Fanca Δ/Δ по сравнению с контролем. Эти хромосомные аберрации были значительно повышены в клетках Fanca Δ/Δ после обработки MMC (фиг. 2B). Эта гиперчувствительность клеток Fance -null согласуется с характеристиками фенотипа FA и указывает на дефект репарации повреждений ДНК.

Рис.2.

Гиперчувствительность MMC и ослабленное накопление репарационных молекул ДНК DSB в клетках Fanca Δ/Δ . ( A ) Анализ выживаемости колоний после обработки MMC. Кривые представляют среднее количество колоний в процентах от необработанных культур с планками погрешностей, показывающими стандартное отклонение. ( B ) Хромосомная аберрация после лечения MMC. Br — хроматидный разрыв; Tr, транслокация; CBr, изохроматидный разрыв, кольцевая или дицентрическая хромосома. ( C и D ) Иммунофлуоресцентный анализ образования очагов после лечения MMC.Клетки обрабатывали 100 нг/мл ММС в течение 1 ч и окрашивали на образование очагов Brca1 ( С ) и Rad51 ( D ) через 9 ч после удаления ММС. Количественное определение частоты очагово-позитивных популяций в клетках дикого типа и Fanca Δ/Δ фибробластов. Каждая полоса представляет собой оценку не менее 300 ядер. ( E ) Отсутствие опосредованного повреждением ДНК моноубиквитинирования Fancd2 в отсутствие Fanca. Fancd2-S, низкомолекулярная изоформа; Fancd2-L, высокомолекулярная моноубиквитинированная изоформа.ММС, митомицин С; HU, гидроксимочевина.

Рис. 2.

Гиперчувствительность MMC и ослабленное накопление молекул репарации DSB ДНК в клетках Fanca Δ/Δ . ( A ) Анализ выживаемости колоний после обработки MMC. Кривые представляют среднее количество колоний в процентах от необработанных культур с планками погрешностей, показывающими стандартное отклонение. ( B ) Хромосомная аберрация после лечения MMC. Br — хроматидный разрыв; Tr, транслокация; CBr, изохроматидный разрыв, кольцевая или дицентрическая хромосома.( C и D ) Иммунофлуоресцентный анализ образования очагов после лечения MMC. Клетки обрабатывали 100 нг/мл ММС в течение 1 ч и окрашивали на образование очагов Brca1 ( С ) и Rad51 ( D ) через 9 ч после удаления ММС. Количественное определение частоты очагово-позитивных популяций в клетках дикого типа и Fanca Δ/Δ фибробластов. Каждая полоса представляет собой оценку не менее 300 ядер. ( E ) Отсутствие опосредованного повреждением ДНК моноубиквитинирования Fancd2 в отсутствие Fanca.Fancd2-S, низкомолекулярная изоформа; Fancd2-L, высокомолекулярная моноубиквитинированная изоформа. ММС, митомицин С; HU, гидроксимочевина.

Поскольку FANCA взаимодействует с BRCA1 (17), а комплекс FA играет важную роль в реакции на повреждение ДНК (2), мы затем исследовали, повлияет ли делеция Fanca на накопление молекул репарации DSB после лечения MMC. В то время как 70% клеток дикого типа содержали очаги Brca1, только 51% клеток Fanca Δ/Δ показали образование очагов после обработки MMC (рис. 2C).Мы также обнаружили, что популяция, положительная по очагам Rad51, всегда была ниже в клетках Fanca Δ/Δ , чем в клетках дикого типа (рис. 2D). Эти результаты предполагают, что рекрутирование молекул репарации ДНК в DSB ослабляется в отсутствие Fanca.

Было показано, что моноубиквитинированный FANCD2 совместно локализуется с RAD51 и BRCA1 в ядерных очагах в ответ на повреждение ДНК, а Fanca находится в коровом комплексе выше пути Fancd2 (2). Затем мы проверили, повлияет ли инактивация Fanca на модификация Fancd2.Как и ожидалось, после обработки ММС и гидроксимочевиной (HU) моноубиквитинирование Fancd2 индуцировалось в клетках дикого типа. Однако моноубиквитинирование Fancd2 не было обнаружено в Fanca -нулевых клетках (фиг.2Е). Эти данные согласуются с представлением о том, что Fanca играет важную роль в ответ на повреждение ДНК путем модулирования пути Fancd2, и указывают на роль Fanca в репарации DSB.

Недостаточная эффективность нацеливания генов в Fanca-нулевых ES клетках

Эффективность нацеливания на гены является суррогатным маркером, отражающим соответствующую активность гомологичной рекомбинации на клеточном уровне.Чтобы исследовать влияние истощения Fanca на эффективность нацеливания на ген, вектор нацеливания на ген hprt -DRGFP (27) был электропорирован в два клона ES-клеток дикого типа (W1, W2) и Fanca . Δ/Δ (h2, C8) генотип. Эффективность нацеливания генов на локус hprt (т.е. гомологичная по сравнению с полной интеграцией) значительно снижена в клетках Fanca Δ/Δ ES по сравнению с клетками дикого типа (таблица I), что позволяет предположить, что разрушение Fanca нарушает гомологичную рекомбинацию, что приводит к снижению эффективности нацеливания на гены.

Таблица I.

Эффективность нацеливания генов в Fanca +/+ и Fanca Δ/Δ ES клетки . Эксперимент 1


. . Эксперимент 2
. . Эксперимент 3
. . 
puro R (×10 −6 ) a
.  6-TG R / puro R (×10 −7 ) b
puro R (×10 −6 ) a
.  6-TG R / puro R (×10 −7 ) b
. пуро R (×10 −6 ) a
. 6-TG R / пуро R (×10 −7 ) b
. 90 871 Fanca + / + W1 325 35,0 (1,08%) с 432 63 .0 (1,46%) 398 48.0 (1,20%) W2 293 275 24,5 (0,90%) 232 232 16.0 (0,69%) 242 (21,5 (0,89% ) Fanca Δ / Δ h2 787 10 (0,12%) 714 9,5 (0,13%) 680  9.0 (0,13%) C8 885 10 (0.11%) 745 745 8,0 (0,10%) 742 742 9.0 (0,12%) 90 871 Fanca + / + C8
клеточные линии . Эксперимент 1
.
. Эксперимент 2
.
. Эксперимент 3
.

puro R (×10 −6 ) a
6-TG R / puro R (×10 −7 ) b
puro R (×10 −6 ) a
6-TG R / puro R (×10 −7 ) b
.
пуро R (×10 −6 ) a
.
6-TG R / пуро R (×10 −7 ) b
.
W1 325 35,0 (1,08%) с 432 63 .0 (1,46%) 398 48.0 (1,20%)
W2 293 275 24,5 (0,90%) 232 232 16.0 (0,69%) 242 (21,5 (0,89% )
Fanca Δ / Δ
h2 787 10 (0,12%) 714 9,5 (0,13%) 680  9.0 (0,13%)
885 10 (0,11%) 745 745 90 (0,10%) 742 9,0 (0,12%)
Таблица I.

Эффективность нацеливания генов в клетках Fanca +/+ и Fanca Δ/Δ ES

Клеточные линии . Эксперимент 1
.
. Эксперимент 2
.
. Эксперимент 3
.
.

.
пуро R (×10 −6 ) a
.
6-TG R / пуро R (×10 −7 ) b
.
пуро R (×10 −6 ) a
.
6-TG R / пуро R (×10 −7 ) b
.
пуро R (×10 −6 ) a
.
6-TG R / пуро R (×10 −7 ) b
.
Fanca + / +
707776 325 35. 0 (1,08%) C C 432 63.0 (1,46%) 398 48,0 (1,20%)
W2 273 273 (0,90%) 232 16.0 0,69%) 242 (21,5 (0,89%)
Fanca Δ / Δ
h2 787 10 ( 0.12%) 714 9.5 (0,13%) 680 9.0 (0.13%) 90 (0,13%) 9.0790 C8 885 10 (0,11%) 745 740 (0,10%) 742 9,0 (0,12%)
Клеточные линии . Эксперимент 1
.
. Эксперимент 2
.
Experiment 3
.  

puro R (×10 −6 ) a
6-TG R / puro R (×10 −7 ) b
puro R (×10 −6 ) a
.
6-TG R / пуро R (×10 −7 ) b
.
пуро R (×10 −6 ) a
.
6-TG R / пуро R (×10 −7 ) b
.
Fanca + / +
707776 325 35.0 (1,08%) C C 432 63. 0 (1,46%) 398 48,0 (1,20%)
W2 273 273 (0,90%) 232 16.0 0,69%) 242 (21,5 (0,89%)
Fanca Δ / Δ
h2 787 10 ( 0.12%) 714 9.5 (0,13%) 680 9.0 (0.13%) 90 (0,13%) 9.0790 C8 885 10 (0,11%) 745 740 (0,10%) 742  9,0 (0,12%) 

Нарушение HDR в клетках фибробластов, лишенных Фанка

Чтобы исследовать роль Fanca в репарации DSB, мы трансфицировали основанный на флуоресценции репортерный субстрат (DRGFP) (29) в фибробласты дикого типа и Fanca Δ/Δ , а изолированные клоны, содержащие одну интактную копию DRGFP, анализировали с помощью Саузерн-блоттинга (рис. 3А и В).Чтобы свести к минимуму источники изменчивости, в анализе рекомбинации использовали не менее семи независимых клонов каждого генотипа. В присутствии I- Sce I в клетках Fanca Δ/Δ наблюдалось 3-кратное снижение GFP-позитивных клеток (~0,5%) по сравнению с клетками дикого типа (~1,5% GFP-положительных клеток). положительные клетки) (рис. 3C и D). Как и ожидалось, мы почти не обнаружили GFP-позитивных клеток в популяциях, трансфицированных ложным вектором (без гена I- Sce I) для обоих генотипов (рис. 3C).Более того, сравнимая эффективность трансфекции экспрессионными плазмидами I- Sce I наблюдалась для клеток дикого типа и клеток фибробластов Fanca Δ/Δ при исследовании путем трансфекции плазмидой, экспрессирующей GFP (данные не показаны). Снижение количества GFP-позитивных Fanca -нулевых клеток свидетельствует о том, что HDR геномных DSB нарушается в отсутствие Fanca.

Рис. 3.

HDR скомпрометирован в Fanca -пустые ячейки. ( A ) Субстрат рекомбинации DRGFP, интегрированный в случайный хромосомный локус (29). ( B ) Саузерн-блоттинг клеток, содержащих репортер DRGFP. Клетки, содержащие одну копию субстрата (обозначены звездочкой), показывают только две полосы одинаковой плотности: одна размером 0,8 т.п.н. (копия iGFP), другая полоса >3,2 т.п.н., содержащая последовательность Sce GFP. ( C ) Репрезентативный проточный цитометрический анализ событий HDR (после DSB) в клетках дикого типа (+/+) и Fanca Δ/Δ (Δ/Δ) после трансфекции I- Sce I, экспрессирующие эндонуклеазу, или ложные векторы (без гена I- Sce I).GFP-позитивная популяция (после DSB) отделяется от GFP-негативной популяции по мере перехода к зеленому. ( D ) Процент GFP-позитивных клеток после трансфекции вектором экспрессии I- Sce I. Столбцы представляют среднее значение по крайней мере семи независимых клонов каждого генотипа из трех независимых экспериментов. Цветную версию этой фигуры см. в дополнительных материалах в Интернете.

Рис. 3.

HDR скомпрометирован в Fanca -пустые ячейки.( A ) Субстрат рекомбинации DRGFP, интегрированный в случайный хромосомный локус (29). ( B ) Саузерн-блоттинг клеток, содержащих репортер DRGFP. Клетки, содержащие одну копию субстрата (обозначены звездочкой), показывают только две полосы одинаковой плотности: одна размером 0,8 т.п.н. (копия iGFP), другая полоса >3,2 т.п.н., содержащая последовательность Sce GFP. ( C ) Репрезентативный проточный цитометрический анализ событий HDR (после DSB) в клетках дикого типа (+/+) и Fanca Δ/Δ (Δ/Δ) после трансфекции I- Sce I, экспрессирующие эндонуклеазу, или ложные векторы (без гена I- Sce I).GFP-позитивная популяция (после DSB) отделяется от GFP-негативной популяции по мере перехода к зеленому. ( D ) Процент GFP-позитивных клеток после трансфекции вектором экспрессии I- Sce I. Столбцы представляют среднее значение по крайней мере семи независимых клонов каждого генотипа из трех независимых экспериментов. Цветную версию этой фигуры см. в дополнительных материалах в Интернете.

Путь SSA особенно затронут в клетках Fanca-null

Затем мы проанализировали пути рекомбинации репарации I- Sce I-индуцированных DSB.В используемой здесь репортерной системе либо HDR, либо NHEJ могут восстанавливать DSB, сгенерированный на сайте I- Sce I (рис. 4А). Пути HDR — STGC, LTGC или SSA (рис. 4A). Только путь STGC-HDR восстановит функциональный GFP; SSA и LTGC вызовут гомологичную делецию, что приведет к нефункциональному GFP; NHEJ может иметь точные или неточные пути (рис. 4А). Репарация DSB через STGC, SSA, LTGC или неточный NHEJ вызывает потерю I- Sce I-сайта и, следовательно, устойчивость к эндонуклеазе I- Sce I.Напротив, SSA и LTGC генерируют сайт Bcg I, который заменяет сайт I- Sce I в субстрате, делая чувствительным к Bcg I. С помощью ПЦР мы амплифицировали фрагмент ДНК, содержащий исходное местоположение I- Сайт Sce I из генома имитатора (без гена I- Sce I) или I- Sce I-трансфицировали ЭС клеток и расщепляли эти продукты ПЦР с помощью I- Sce I или Bcg I. В то время как аналогичные доли потери I-сайта I- Sce (~30–35% продуктов ПЦР) были обнаружены как в клетках дикого типа, так и в клетках Fanca Δ/Δ (рис. 4B), относительное количество Прирост I-сайта Bcg , указывающий на STGC, SSA или LTGC, был значительно снижен до 12–15% в клетках Fanca Δ/Δ по сравнению с 23–25% в клетках дикого типа (рис. 4C).Эти результаты показывают, что удаление Fanca влияет на репарацию DSB с помощью путей HDR.

Рис. 4.

Анализ путей репарации ДЦР в клетках Fanca Δ/Δ . ( A ) Стратегия ПЦР для обнаружения путей репарации DSB. Сайт I- Sce I (черный сегмент) и сайт Bcg I (полосатый сегмент) расположены в SceGFP и iGFP соответственно. Сайты связывания и ориентация праймеров для ПЦР (DF1, SAF, DR, SA-R1 и SA-R2) указаны под соответствующей областью.Показаны четыре предполагаемых продукта, происходящих из исходной геномной области сайта I- Sce I после STGC, SSA, NHEJ (неточный и точный) или LTGC (связанный с NHEJ), и один продукт из DRGFP (неразрезанный субстрат). . ( B и C ) Анализ гомологичной репарации DSB. Продукт ПЦР длиной ~723 п.н., полученный с помощью праймеров DF1 и DR, расщепляли ферментами I- Sce I или Bcg I. ( B ) I- Sce I R фрагменты, полученные в результате STGC, SSA, LTGC или неточной NHEJ, устойчивые к расщеплению I- Sce I; Фрагменты I- Sce I S представляют собой либо клетки без образования DSB in vivo из-за отсутствия расщепления I- Sce I, либо клетки, которые восстановили DSB с помощью точного NHEJ.( C ) Фрагменты Bcg I S возникают из DSB, подвергшихся STGC, SSA или LTGC и чувствительны к Bcg I. Фрагменты Bcg I R возникают из клеточных популяций без образования DSB in vivo или восстановленный через NHEJ. Контролем служили ложнотрансфицированные (без гена I- Sce I) клоны. Столбцы (в B и C) представляют собой среднее значение трех независимых экспериментов.

Рис. 4.

Анализ путей репарации DSB в клетках Fanca Δ/Δ . ( A ) Стратегия ПЦР для обнаружения путей репарации DSB. Сайт I- Sce I (черный сегмент) и сайт Bcg I (полосатый сегмент) расположены в SceGFP и iGFP соответственно. Сайты связывания и ориентация праймеров для ПЦР (DF1, SAF, DR, SA-R1 и SA-R2) указаны под соответствующей областью. Показаны четыре предполагаемых продукта, происходящих из исходной геномной области сайта I- Sce I после STGC, SSA, NHEJ (неточный и точный) или LTGC (связанный с NHEJ), и один продукт из DRGFP (неразрезанный субстрат). .( B и C ) Анализ гомологичной репарации DSB. Продукт ПЦР длиной ~723 п.н., полученный с помощью праймеров DF1 и DR, расщепляли ферментами I- Sce I или Bcg I. ( B ) I- Sce I R фрагменты, полученные в результате STGC, SSA, LTGC или неточной NHEJ, устойчивые к расщеплению I- Sce I; Фрагменты I- Sce I S представляют собой либо клетки без образования DSB in vivo из-за отсутствия расщепления I- Sce I, либо клетки, которые восстановили DSB с помощью точного NHEJ.( C ) Фрагменты Bcg I S возникают из DSB, подвергшихся STGC, SSA или LTGC и чувствительны к Bcg I. Фрагменты Bcg I R возникают из клеточных популяций без образования DSB in vivo или восстановленный через NHEJ. Контролем служили ложнотрансфицированные (без гена I- Sce I) клоны. Столбцы (в B и C) представляют собой среднее значение трех независимых экспериментов.

Далее мы проанализировали состояние SSA после репарации DSB, индуцированных I- Sce I в клетках Fanca Δ/Δ , с помощью ПЦР-амплификации с использованием набора праймеров (SAF и SA-R2) и сравнили эти Продукты ПЦР с продуктами ПЦР, полученными с помощью STGC и NHEJ, и неразрезанного субстрата DRGFP (с использованием праймеров SAF и SA-R1) (рис. 4А).Продукты, генерируемые SSA, были значительно снижены в клетках Fanca Δ/Δ по сравнению с клетками дикого типа (фиг. 5A и B). В качестве контроля Brca2/Fancd1 -null клетки яичника китайского хомячка демонстрировали повышенную активность SSA (рис. 5A и B), что согласуется с предыдущими наблюдениями (36). Чтобы проверить потенциальный вклад LTGC, также измеренный с помощью ПЦР с праймерами SAF и SA-R2, в аутентичные события SSA, мы выращивали клетки в присутствии пуромицина после восстановления DSB, что устранило бы клетки, которые подверглись SSA и потеряли пуромицин. устойчивый ген (рис. 4А).С этой целью мы использовали один набор праймеров (SAF и SA-R2), который будет исключительно амплифицировать области вокруг сайта Bcg I посредством LTGC после выбора пуромицинового препарата, и другой набор праймеров (SAF и SA-R1) в качестве внутреннего управления (рис. 4А). В этом анализе мы почти не обнаружили каких-либо продуктов ПЦР-амплификации с использованием праймеров SAF и SA-R2 (данные не показаны), что исключает значительный вклад события LTGC в предполагаемый продукт SSA, показанный на рисунке 5A. В совокупности отсутствие Fanca снижает HDR главным образом в пути SSA, тогда как делеция Brca2/Fancd1, по-видимому, усиливает SSA.

Рис. 5.

SSA-путь репарации DSB нарушен в клетках Fanca Δ/Δ . ( A ) Репрезентативный ПЦР-анализ продуктов SSA из мышиных Fanca Δ/Δ клеток и Fancd1/Brca2 нулевых клеток CHO. Указаны продукты ПЦР размером 0,9 т.п.н., образованные праймерами SAF и SA-R1 (включая продукты STGC и NHEJ, а также продукты из неразрезанного DRGFP), и продукт ПЦР размером 0,8 т.п.н., полученный от праймеров SAF и SA-R2 (продукты SSA).( B ) Количественное определение продуктов ПЦР для обнаружения SSA. Процент SSA (%) получен из отношения полосы 0,8 т.п.о. к полосам 0,8 + 0,9 т.п.о. в части (A). Столбцы представляют среднее значение трех независимых экспериментов.

Рис. 5.

SSA-путь репарации DSB нарушен в клетках Fanca Δ/Δ . ( A ) Репрезентативный ПЦР-анализ продуктов SSA из мышиных Fanca Δ/Δ клеток и Fancd1/Brca2 нулевых клеток CHO.Указаны продукты ПЦР размером 0,9 т.п.н., образованные праймерами SAF и SA-R1 (включая продукты STGC и NHEJ, а также продукты из неразрезанного DRGFP), и продукт ПЦР размером 0,8 т.п.н., полученный от праймеров SAF и SA-R2 (продукты SSA). ( B ) Количественное определение продуктов ПЦР для обнаружения SSA. Процент SSA (%) получен из отношения полосы 0,8 т.п.о. к полосам 0,8 + 0,9 т.п.о. в части (A). Столбцы представляют среднее значение трех независимых экспериментов.

Обсуждение

Исследования с использованием клеток FA человека и мутантных куриных клеток DT40 показали роль различных белков FA в репарации DSB.Настоящее исследование с использованием мышиных Fanca -null клеток впервые идентифицирует Fanca как неотъемлемый компонент каскада биологической реакции ДНК DSB путем стимулирования путей как HDR, так и, в частности, SSA. Настоящее исследование связывает белок FANCA с ранней стадией процесса репарации гомологичной рекомбинацией.

Пациенты с FA демонстрируют высокую гетерогенность генетического фона и мутаций в диапазоне генов FANCA от внутригенной делеции, усечения белка до нулевой мутации.Поскольку внутригенная делеция в области экзонов 37–39 была обнаружена у пациентов с FA, мы создали клетки с соответствующим нарушением на С-конце гена Fanca . Вестерн-блоттинг подтвердил полное отсутствие белка Fanca в этих клетках. Используя недавно сконструированные клетки мыши Fanca -null, настоящее исследование демонстрирует прямые генетические доказательства роли комплекса FA в репарации HDR DSB в клетках млекопитающих. Дефекты гомологичной репарации в мутантных клетках Fanca , скорее всего, ответственны за фенотип хромосомной нестабильности (хроматидные разрывы и слияния хромосом), наблюдаемый в клетках FA, а также в наших нокаутных клетках Fanca .Есть несколько предполагаемых механизмов, с помощью которых Fanca может участвовать в HDR. Fanca может модулировать рекрутирование молекул, которые участвуют в репарации DSB или передаче сигналов к сайтам DSB. Было показано, что FANCA необходим для стабильного функционирующего основного комплекса и, таким образом, для моноубиквитинирования FANCD2, и только моноубиквитинированная форма FANCD2 способна совместно локализоваться с BRCA1 и RAD51 (13, 22). В связи с этим мы обнаружили, что Fanca требуется для моноубиквитинирования Fancd2 и что образование фокусов Rad51 и Brca1 при разрывах ДНК было снижено в Fanca -нулевых мышиных клетках.Эти результаты согласуются с предыдущими исследованиями, показывающими ослабленное рекрутирование BRCA1 и RAD51 в ядерные очаги в клетках FA человека ( FANCA/C/G ) (37, 38). Возможно, что Fanca участвует в репарации гомологов непосредственно через взаимодействие с Brca1 (17). Более того, Fanca может служить точкой стыковки на сайтах DSB для сборки компонентов BRCA1-ассоциированного комплекса, таких как BRCA1 и RAD51. Наконец, Fanca может участвовать в первоначальном обнаружении DSB. В связи с этим стоит отметить, что FANCD2 взаимодействует с NBS1 в ответ на повреждение ДНК (21), а в клетках FANCC/G после обработки MMC было обнаружено замедленное образование очагов Mre11 (37).Недавнее исследование также показывает, что ATR связывает моноубиквитинирование FANCD2 с реакцией на повреждение ДНК (39). Интересно, что мы также обнаружили, что образование фокусов γ-h3Ax было подавлено в Fanca -нулевых клетках (данные не показаны).

Путь генной конверсии восстанавливает DSB путем получения генетической информации от интактного гомолога (сестринской хроматиды или гомологичной хромосомы) посредством обмена цепями. В качестве альтернативного пути репарации DSB, зависящего от гомологии, события SSA могут вызывать делеции определенных последовательностей (склонность к ошибкам) ​​(40).SSA и генная конверсия имеют некоторые общие характеристики, поскольку они оба используют одноцепочечную ДНК в качестве общего промежуточного звена и имеют общие компоненты, такие как RAD52 (40). Мы показываем, что отсутствие Fanca отменяет убиквитинирование нижестоящего эффектора комплекса FA, Fancd2, и что продукты репарации через путь SSA особенно низки в Fanca -нулевых клетках, что способствует общему дефициту HDR. Эти данные согласуются с наблюдениями в клетках FA человека, показывающими, что комплекс FA и убиквитинирование FANCAD2 участвуют в SSA и HDR (41).Следовательно, хотя снижение пути SSA (склонного к ошибкам) ​​вызвало бы меньшую геномную нестабильность, общие дефекты HDR, скорее всего, ответственны за фенотип хромосомной нестабильности FA-клеток. В совокупности наши данные помещают путь FA на раннюю стадию HDR DSB. Эти находки также указывают на то, что резекция цепи ДНК является одним из этапов, который может регулироваться путем FA, учитывая важность отдельных цепей как субстратов как для генной конверсии, так и для SSA.

В то время как глобальная репарация DSB с помощью HDR преобладает у низших эукариот, например.грамм. дрожжей, высшие эукариотические клетки развили несколько путей восстановления повреждений DSB ДНК, а именно с помощью NHEJ и HDR (42). Клетки FA, которые дефектны в SSA, неспособны точно настроить свой выбор путей HDR и могут более широко использовать NHEJ, и это может увеличить частоту хромосомных аберраций и скорость мутаций, ведущих к неоплазиям.

Дополнительный материал

Дополнительный материал доступен в Интернете по адресу: http://carcin.oxfordjournals.org/

Мы благодарим д-ра Дитера Ритмахера за вектор pTV-Flox, д-ра Фре Арверта за антитела против Fanca, д-ра Дэвида М. Ливингстона за мышиное моноклональное антитело против BRCA1, д-ра Алана Д.Д’Андреа за анти- — FANCD2 кроличье антитело E35. Мы также благодарны Janina Radszweski, Susanne Rothe, Srinivas Patnaik и Cuenin Cyrille за отличную техническую помощь. Эта работа была поддержана Fritz-Thyssen-Stiftung и Association pour la Recherche sur le Cancer (ARC).

Заявление о конфликте интересов : Не объявлено.

Каталожные номера

1.

Фанкони, Г. (

1967

) Семейная конституциональная панмиелоцитопатия, анемия Фанкони (ФА). I. Клинические аспекты.

Семин. Гематол.

,

4

,

233

–240. 2.

Д’Андреа, А.Д. и Громпе, М. (

2003

) Путь анемии Фанкони/BRCA.

Нац. Преподобный Рак

,

3

,

23

–34. 3.

Сасаки, М.С. и Тономура, А. (

1973

) Высокая восприимчивость анемии Фанкони к поломке хромосом агентами, сшивающими ДНК.

Рак Рез.

,

33

,

1829

–1836.4.

Исида, Р. и Бухвальд, М. (

1982

) Чувствительность лимфобластов анемии Фанкони к ДНК-сшивающим и алкилирующим агентам.

Рак Рез.

,

42

,

4000

–4006. 5.

Йоэндже, Х. и Патель, К.Дж. (

2001

) Новые генетические и молекулярные основы анемии Фанкони.

Нац. Преподобный Жене.

,

2

,

446

–457. 6.

Митей А.Р., Левитус М., Сюэ Ю. и др. . (

2004

) Х-сцепленное наследование анемии Фанкони комплементарной группы В.

Нац. Жене.

,

36

,

1219

–1224.7.

Ротфус, А. и Громпе, М. (

2004

) Кинетика репарации межцепочечных поперечных связей геномной ДНК: свидетельство зависимой от двухцепочечного разрыва ДНК активации пути анемии Фанкони/BRCA.

мол. Клетка. биол.

,

24

,

123

–134. 8.

Аккари Ю.М., Бейтман Р.Л., Рейфстек К.А., Олсон, С.Б. и Громпе, М. (

2000

) Репликация ДНК необходима, чтобы вызвать клеточные ответы на псорален-индуцированные межцепочечные поперечные связи ДНК.

мол. Клетка. биол.

,

20

,

8283

–8289. 9.

Дронкерт, М.Л. и Канаар, Р. (

2001

) Репарация межцепочечных поперечных связей ДНК.

Мутат. Рез.

,

486

,

217

–247. 10.

Донахью, С.Л. и Кэмпбелл, С. (

2002

) Дефект репарации двухцепочечного разрыва ДНК в фибробластах анемии Фанкони.

Дж. Биол. хим.

,

277

,

46243

–46247. 11.

Дигвид, М. (

2003

) Реакция на канцерогены окружающей среды при нарушениях, связанных с репарацией ДНК.

Токсикология

,

193

,

111

–124. 12.

Meetei, A.R., de Winter, J.P., Medhurst, A.L. и др. . (

2003

) При анемии Фанкони дефицит новой убиквитинлигазы.

Нац. Жене.

,

35

,

165

–170. 13.

Гарсия-Игера И., Танигути Т., Ганесан С., Мейн М.С., Тиммерс С., Хейна Дж., Громпе М. и Д’Андреа, А.Д. (

2001

) Взаимодействие белков анемии Фанкони и BRCA1 по общему пути.

мол. Сотовый

,

7

,

249

–262.14.

Мойнахан, М.Э., Пирс, А.Дж. и Ясин, М. (

2001

) BRCA2 необходим для направленной по гомологии репарации хромосомных разрывов.

мол. Сотовый

,

7

,

263

–272. 15.

Дэвис А.А., Массон Дж.Ю., Макилрайт М.Дж., Стасиак А.З., Стасиак А., Венкитараман А.Р. и Уэст, С.К. (

2001

) Роль BRCA2 в контроле рекомбинации RAD51 и белка репарации ДНК.

мол. Сотовый

,

7

,

273

–282. 16.

Ян Х., Джеффри П.Д., Миллер Дж., Киннукан Э., Сунь Ю., Тома Н.Х., Чжэн Н., Чен П.Л., Ли У.Х. и Павлетич, Н.П. (

2002

) Функция BRCA2 в связывании ДНК и рекомбинации из структуры BRCA2-DSS1-оцДНК.

Наука

,

297

,

1837

–1848.17.

Фолиас А., Маткович М., Бруун Д., Рейд С., Хейна Дж., Громпе М., Д’Андреа А. и Моисей, Р. (

2002

) BRCA1 напрямую взаимодействует с белком анемии Фанкони FANCA.

Гул. Мол. Жене.

,

11

,

2591

–2597. 18.

Хуссейн, С., Уилсон, Дж. Б., Медхерст, А. Л. и др. .(

2004

) Прямое взаимодействие FANCD2 с BRCA2 в путях ответа на повреждение ДНК.

Гул. Мол. Жене.

,

13

,

1241

–1248. 19.

Хуссейн С., Витт Э., Хубер П.А., Медхерст А.Л., Эшворт А. и Мэтью, К.Г. (

2003

) Прямое взаимодействие белка анемии Фанкони FANCG с BRCA2/FANCD1.

Гул. Мол. Жене.

,

12

,

2503

–2510. 20.

Ван, X., Андреассен, P.R. и Д’Андреа, А.Д. (

2004

) Функциональное взаимодействие моноубиквитинированных FANCD2 и BRCA2/FANCD1 в хроматине.

мол. Клетка. биол.

,

24

,

5850

–5862.21.

Наканиши К., Танигучи Т., Ранганатан В., Нью Х.В., Моро Л.А., Стоцкий М., Мэтью К.Г., Кастан М.Б., Уивер Д.Т. и Д’Андреа, А.Д. (

2002

) Взаимодействие FANCD2 и NBS1 в реакции на повреждение ДНК.

Нац. Клеточная биол.

,

4

,

913

–920. 22.

Танигути Т., Гарсия-Игера И., Андреассен, П.Р., Грегори, Р.К., Громпе, М. и Д’Андреа, А.Д. (

2002

) Специфическое для S-фазы взаимодействие белка анемии Фанкони, FANCD2, с BRCA1 и RAD51.

Кровь

,

100

,

2414

–2420. 23.

Ямамото К., Исиаи М., Мацусита Н., Аракава Х., Ламердин Дж. Э., Буэрстедде Дж. М., Танимото М., Харада М., Томпсон Л.Х. и Таката, М. (

2003

) Анемия Фанкони Белок FANCG в смягчении индуцированных радиацией и ферментами двухцепочечных разрывов ДНК путем гомологичной рекомбинации в клетках позвоночных.

мол. Клетка. биол.

,

23

,

5421

–5430. 24.

Нидзвидз, В., Мозедейл, Г., Джонсон, М., Онг, С.Ю., Пейс, П. и Патель, К.Дж. (

2004

) Ген анемии Fanconi FANCC способствует гомологичной рекомбинации и подверженной ошибкам репарации ДНК.

мол. Сотовый

,

15

,

607

–620. 25.

Ямамото К., Хирано С., Исиаи М. и др. . (

2005

) Белок анемии Фанкони FANCD2 способствует конверсии гена иммуноглобулина и репарации ДНК посредством механизма, связанного с гомологичной рекомбинацией.

мол. Клетка.биол.

,

25

,

34

–43. 26.

Мостославский Р., Сингх Н., Тензен Т. и др. . (

2001

) Асинхронная репликация и исключение аллелей в иммунной системе.

Природа

,

414

,

221

–225.27.

Пирс, А.Дж., Ху, П., Хан, М., Эллис, Н. и Ясин, М. (

2001

) Концевой белок Ku ДНК модулирует гомологичную репарацию двухцепочечных разрывов в клетках млекопитающих.

Гены Дев.

,

15

,

3237

–3242. 28.

Ян, Ю.Г., Кортес, У., Патнаик, С., Джасин, М. и Ван, З.К. (

2004

) Абляция PARP-1 не мешает репарации двухцепочечных разрывов ДНК, но ставит под угрозу реактивацию застопорившихся репликационных вилок.

Онкоген

,

23

,

3872

–3882. 29.

Пирс, А.Дж., Джонсон, Р.Д., Томпсон, Л.Х. и Ясин, М. (

1999

) XRCC3 способствует гомологически направленной репарации повреждений ДНК в клетках млекопитающих.

Гены Дев.

,

13

,

2633

–2638.30.

ван де Вругт, Х.Дж., Ченг, Н.К., де Врис, Ю., Руиманс, М.А., де Гроот, Дж., Шепер, Р.Дж., Чжи, Ю., Хоатлин, М. Е., Джоендже, Х. и Арверт, Ф. (

2000

) Клонирование и характеристика гена мышиной анемии Фанкони группы А: белок Fanca экспрессируется в лимфоидных тканях, семенниках и яичниках.

Мамм. Геном

,

11

,

326

–331.31.

Ченг, Н.К., ван де Вругт, Х.Дж., ван дер Валк, М.А., Оостра, А.Б., Кримпенфорт, П., де Врис, Ю., Джоэнье, Х., Бернс, А. и Арверт, Ф. (

2000

) Мыши с целенаправленным нарушением анемии Фанкони, гомолога Fanca.

Гул. Мол. Жене.

,

9

,

1805

–1811. 32.

Нолл М., Баттейл К.П., Бейтман Р., Лакс Т.П., Рэтбан К., Рейфстек К., Бэгби Г., Файнголд М., Олсон С. и Громпе, М. (

2002

) Мыши с двойными мутациями анемии Фанкони групп А и С: функциональное свидетельство мультибелкового комплекса анемии Фанкони.

Экспл. Гематол.

,

30

,

679

–688. 33.

Вонг, Дж. К., Алон, Н., Маккерли, К., Хуанг, Дж. Р., Мейн, М.С. и Бухвальд, М. (

2003

) Направленное разрушение экзонов с 1 по 6 гена анемии Фанкони группы А приводит к задержке роста, штаммоспецифической микрофтальмии, дефектам мейоза и гипоплазии первичных зародышевых клеток.

Гул. Мол. Жене.

,

12

,

2063

–2076. 34.

Бигелоу С.Б., Рэри Дж.М. и Бендер, М.А. (

1979

) Радиочувствительность хромосом G2 при анемии Фанкони.

Мутат. Рез.

,

63

,

189

–199. 35.

Хеддл, Дж. А., Лю, К. Б., Сондерс, Э. Ф. и Бенц Р.Д. (

1978

) Чувствительность к пяти мутагенам при анемии Фанкони, измеренная микроядерным методом.

Рак Рез.

,

38

,

2983

–2988.36.

Старк, Дж. М., Пирс, А. Дж., О, Дж., Пастинк, А. и Ясин, М. (

2004

) Генетические этапы гомологичной репарации млекопитающих с отчетливыми мутагенными последствиями.

мол. Клетка. биол.

,

24

,

9305

–9316. 37.

Пихьерри, П., Авербек, Д. и Росселли, Ф. (

2002

) Для зависимой от перекрестных связей ДНК субнуклеарной сборки RAD50/MRE11/NBS1 требуется белок С анемии Фанкони.

Гул. Мол. Жене.

,

11

,

2531

–2546. 38.

Дигвид М., Роте С., Демут И., Шольц Р., Шиндлер Д., Штумм М., Громпе М., Джордан А. и Сперлинг, К. (

2002

) Затухание образования очагов репарации ДНК, содержащих RAD51, при анемии Фанкони.

Канцерогенез

,

23

,

1121

–1126.39.

Андреассен, П.Р., Д’Андреа, А.Д. и Танигучи, Т. (

2004

) ATR связывает моноубиквитинирование FANCD2 с реакцией на повреждение ДНК.

Гены Дев.

,

18

,

1958

–1963. 40.

Дудас, А. и Хованец, М. (

2004

) репарация двухцепочечных разрывов ДНК путем гомологичной рекомбинации.

Мутат. Рез.

,

566

,

131

–167. 41.

Наканиши К., Ян Ю.Г., Пирс А.Дж., Танигучи Т., Дигвид М., Д’Андреа А.Д., Ван З.К. и Ясин, М. (

2005

) Путь моноубиквитинирования анемии Фанкони человека способствует гомологичной репарации ДНК.

Проц. Натл акад. науч. США

,

102

,

1110

–1115.42.

Запад, Южная Каролина (

2003

) Молекулярные представления о рекомбинации белков и их контроле.

Нац. Преподобный Мол. Клеточная биол.

,

4

,

435

–445.

Примечания автора

Международное агентство по изучению рака (IARC), 150 Cours Albert Thomas, F-69008 Lyon, France, 1Memorial Sloan-Kettering Cancer Center, New York, NY 10021, USA и 2Institut fur Humangenetik, Charite-Campus Virchow-Klinikum, Humboldt Universitat zu Berlin, Augustenburger Platz 1, 13353 Berlin, Germany

Carcinogenesis vol.26 № 10 © Издательство Оксфордского университета, 2005 г .; все права защищены.

Добавить комментарий

Ваш адрес email не будет опубликован.