12 инфекций пцр: Анализ ПЦР на 12 инфекций в Москве

Содержание

Анализ ПЦР на 12 инфекций в Москве

Мед Лайт

11 отзывов

многопрофильный медицинский центр

Диагностика ИППП-12 (количественный):Цитомегаловирус(обнаружение ДНК)Вирус простого герпеса HSV тип 1,2 (обнаружение ДНК)Вирус папилломы человека (HPV) тип 16Вирус папилломы человека (HPV) тип 18Chlamydia trachomatis, (обнаружение ДНК)Mycoplasma hominis, (обнаружение ДНК)Mycoplasma genitalium, (обнаружение ДНК)Ureaplasma spp, (обнаружение ДНК)Neisseria gonorrhoeae,(обнаружение ДНК)Gardnerella vaginalis,(обнаружение ДНК)Trichomonas vaginalis, (обнаружение ДНК)Candida albicans,(обнаружение ДНК)

г. Москва, ул. Народного ополчения, д. 23 к.3

пн-пт 09:00 — 20:00 сб 09:00 — 20:00

8 (495) 185-01-01

Центр перинатальной профилактики

2 отзыва

многопрофильный медицинский центр

анализ+мазок

г. Москва, ул. Ленинская Слобода, д. 4

пн-пт 09:00 — 18:00

8 (495) 185-01-01

Евромед

1511 отзывов

многопрофильный медицинский центр

г. Москва, ул. Красина, д. 14, стр. 2

пн-пт 08:00 — 20:00 сб 08:00 — 20:00 вс 08:00 — 20:00

8 (499) 519-36-55

Первый доктор

1122 отзыва

многопрофильный медицинский центр

г. Москва, ул. Киевская, д. 22

пн-пт 09:00 — 21:00 сб 09:00 — 21:00 вс 09:00 — 21:00

8 (499) 116-76-81

CMD Рязанский проспект

414 отзывов

многопрофильный медицинский центр

г. Москва, ул. Рязанский пр-т, д. 38

пн-пт 07:00 — 20:00 сб 07:30 — 19:00 вс 07:30 — 18:00

8 (499) 116-79-41

CMD Текстильщики

17 отзывов

многопрофильный медицинский центр

г. Москва, ул. Люблинская, д. 9 к. 1

пн-пт 07:00 — 20:00 сб 07:30 — 19:00 вс 07:30 — 18:00

8 (495) 185-01-01

HBP clinic

207 отзывов

многопрофильный медицинский центр

г. Москва, ул. Зоологическая, д. 12, корп. 2

пн-пт 09:00 — 21:00 сб 09:00 — 21:00 вс 09:00 — 19:00

8 (495) 185-01-01

По вашему запросу найдено мало клиник
Мы рекомендуем вам обратиться в лучшие клиники и центры Москвы, представленные ниже.
Или позвоните нам по телефону 8 (495) 185-01-01, и оператор подберёт для вас врача и запишет на приём. Медицина и Красота на Павелецкой

1481 отзыв

многопрофильный медицинский центр

Первичная стоимость приёма — высокая

г. Москва, 6-й Монетчиковский пер., д. 19

пн-пт 08:00 — 21:00 сб 08:00 — 21:00 вс 08:00 — 21:00

8 (499) 519-34-67

Медцентр ОН КЛИНИК на Цветном бульваре

15971 отзыв

многопрофильный медицинский центр

Первичная стоимость приёма — низкая

г. Москва, ул. Цветной б-р, д. 30, корп. 2

пн-пт 08:00 — 21:00 сб 08:00 — 21:00 вс 08:00 — 21:00

8 (499) 519-37-05

МедЦентрСервис на Нов. Черемушках

408 отзывов

медицинский центр

Первичная стоимость приёма — высокая

г. Москва, ул. Гарибальди, д. 36

пн-пт 00:00 — 24:00 сб 00:00 — 24:00 вс 00:00 — 24:00

8 (499) 116-81-05

Анализы на ПЦР-12, цены в лаборатории KDL

Выберите требуемый вид биоматериала

Соскобы из урогенитального тракта не берутся в течение суток после местной терапии (свечи, мази, спринцевания), после полового контакта и во время менструации у женщин. После кольпоскопии, интравагинального УЗИ должно пройти 48 часов. В случае наличия признаков острого воспаления необходимость взятия мазка определяется лечащим врачом. Если необходимо получить соскоб из уретры, то перед взятием материала нужно не мочиться 1,5 — 2 часа. Если исследование назначается для контроля излеченности, то взятие материала на исследование методом ПЦР возможно не ранее, чем через 28 дней после окончания приема антибиотиков, на микробиологические исследования не ранее,чем через 14 дней.

Накануне исследования не применять местные лекарственные препараты и процедуры, исключить половой акт. При взятии соскоба из уретры не мочиться в течение 1,5-2 часов до процедуры. Если исследование назначается для контроля излеченности, то взятие материала на исследование методом ПЦР возможно не ранее, чем через 28 дней после окончания приема антибиотиков, на микробиологические исследования не ранее,чем через 14 дней.

Смешанный соскоб урогенитального тракта не берется на фоне местной терапии (свечи, мази, спринцевания) и во время менструации у женщин. После кольпоскопии, интравагинального УЗИ или полового контакта должно пройти 48 часов. Если есть необходимость взятия материала из уретры, то перед взятием материала нужно не мочиться 1,5 — 2 часа. Если исследование назначается для контроля излеченности, то взятие материала на исследование возможно через 14-21 день после окончания приема антибиотиков.

Соскобы из урогенитального тракта не берутся в течение суток после местной терапии (свечи, мази, спринцевания), после полового контакта и во время менструации у женщин. После кольпоскопии, интравагинального УЗИ должно пройти 48 часов. В случае наличия признаков острого воспаления необходимость взятия мазка определяется лечащим врачом. Если необходимо получить соскоб из уретры, то перед взятием материала нужно не мочиться 1,5 — 2 часа. Если исследование назначается для контроля излеченности, то взятие материала на исследование методом ПЦР возможно не ранее, чем через 28 дней после окончания приема антибиотиков, на микробиологические исследования не ранее,чем через 14 дней.

Анализы на половые инфекции ИППП-12 со скидкой до 50%

Информация об анализе

Инфекции, передаваемых половым путем, могут протекать с яркими жалобами, а могут быть незаметны, приводя к осложнениям и представляя угрозу для полового партнера, а у беременной женщины для ребенка.

Сдавать комплекс желательно перед началом новых половых отношений, через 2 недели после незащищенного или случайного полового контакта, особенно если не была проведена профилактическая антибактериальная терапия. 

В случае наличия жалоб (выделения из влагалища, болезненность при половом акте и мочеиспускании) результаты анализов помогут выявить основных возбудителей инфекции.

Ваш партнер может сдать комплекс анализов ИППП-12 для мужчин.

В этот комплекс не входят анализы на ВИЧ, сифилис и гепатиты, т.к. они выполняются по крови. Их можно сдать в комплексе Группа риска.

Также комплекс ИППП для женщин не включает высокоонкогенные типы вируса папилломы человека, которые можно выявить в анализе Вирусы папилломы человека типы 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, типирование ДНК.

Метод исследования — ПЦР Real Time

Материал для исследования — Урогенитальный соскоб, Мужчины — соскоб из уретры, Женщины — соскоб из цервикального канала

Состав и результаты

Срок исполнения

Анализ будет готов в течение 2 дней, исключая субботу, воскресенье и день забора. Срок может быть увеличен на 1 день в случае необходимости. Вы получите результаты на эл. почту сразу по готовности.

Расшифровку мы направим на эл.почту в течение 1 дня, исключая субботу и воскресенье.

Срок исполнения: 2 дня, исключая субботу и воскресенье (кроме дня взятия биоматериала)

Подготовка к анализу

Заранее

Если вы беременны, перед сдачей мазков обязательно предупредите медицинский центр по телефону заранее.

Забор мазков на исследование осуществляется в кабинете гинеколога у женщин и уролога или венеролога у мужчин.

Забор у женщин не проводится во время менструации (на фоне кровянистых выделений) и не рекомендуется за 5 дней до начала предполагаемой менструации.

Общие правила подготовки:

  • обсудите с врачом прием антибактериальных препаратов и препаратов, содержащих микроорганизмы, т.к. это может приводить к ложноотрицательным и ложноположительным результатам,
  • рекомендуется проводить забор мазков не ранее, чем через 2 недели после законченного курса лечения,
  • 72 часа не вступайте в половой контакт,
  • для женщин 48 часов не проводите кольпоскопию и трансвагинальное УЗИ, не используйте местные хлорсодержащие и антибактериальные препараты.
В день сдачи
  • В день сдачи мазка не проводите гигиенические процедуры половых органов (для женщин также спринцевание влагалища, не используйте тампоны и влажные салфетки).
  • В течение 2-х часов до анализа воздержитесь от посещения туалета (при заборе мазка из уретры).

Процедура у мужчин
Для взятия мазка мужчина стоит, медработник убирает слизь и вводит в уретру одноразовый зонд на глубину до 3-4 см, осторожно двигая инструмент, извлекает его из уретры.

Процедура у женщин
Для взятия мазка женщина садится в гинекологическое кресло, медработник осматривает половые пути, вводит во влагалище зеркало — стерильный инструмент, убирает слизь.

Далее зондом берёт материал из наиболее поражённой области. Это может быть: задний свод влагалища, шейка матки, уретра.

Расшифровка результатов

Расшифровка выполняется для женщин старше 18 лет только при возможности проанализировать результаты комплекса анализов и не выполняется при выполнении части анализов. Мы можем отказать в выполнении Расшифровки по своему усмотрению с возвратом оплаты.

Она позволяет оценить значение выявленных возбудителей инфекций.

Расшифровка направляется на эл. почту в течение 1 дня после выполнения анализов, исключая субботу и воскресенье.

Расшифровка носит информационный и рекомендательный характер, не заменяет полноценный прием и консультацию врача. В основу данной расшифровки заложено условие – строгое соблюдение правил подготовки к сдаче анализов.

ИППП-12 для женщин

В настоящее время комплекс инфекций передающихся половым путём (ИППП) включает в себя более 20 заболеваний, вызываемых бактериями, вирусами, простейшими. Объединяющим признаком для данной группы заболеваний является заражение в основном во время полового контакта. Инфицирование происходит при контакте зараженных жидкостей организма больного (например, спермы и влагалищных выделений) со слизистой оболочкой партнера. Инфекция может также передаваться от инфицированной матери плоду и новорожденному. Инфицирование бытовым путем через полотенца, туалетные принадлежности, и т.п. крайне редко возможно для некоторых заболеваний.

Каждый год во всем мире, по оценкам разных авторов, заражается ИППП около 330 миллионов человек. Самыми распространенными заболеваниями определены трихомониаз (около 120 млн.), хламидиоз (около 50 млн.) и гонорея (около 25 млн.). В России также наблюдается постоянный рост заболеваний передающихся половым путем. 

Продолжительность периода с момента заражения до появления симптомов может варьировать от 2-3 дней до нескольких недель в зависимости от инфекции. Об инфицировании можно судить по следующим симптомам:

  • выделения из влагалища;
  • боль при мочеиспускании и во время полового акта;
  • появление сыпи, язвочек в области гениталий.

Но при этом, необходимо учитывать, что заболевание может протекать и бессимптомно. Инфекция, которую вовремя не диагностировали и не пролечили ведет к развитию серьёзных осложнений в виде воспалительных заболеваний органов малого таза и в итоге к бесплодию.

Многие возбудители широко распространены и могут сохраняться в организме длительное время, проявляя себя в периоды стресса, снижения иммунитета, представляя угрозу для плода во время беременности, т.к. способны передаваться от матери к плоду через плаценту или в родах.

Вирусы папилломы человека высокого онкогенного риска связаны с дисплазией и раком шейки матки, поэтому важно проверяться на эти вирусы регулярно.

Помните, что выявление некоторых возбудителей требует от вас решительных действий, информирование полового партнера с целью обследования и лечения.

ПЦР 12 инфекций, цена на комплекс анализов в «Клиника №1», сдать в г. Химки

Инфекции, передаваемые половым путем, представляют собой широкую группу инфекций, и передаются от одного человека к другому во время половой жизни. Это проблема, масштабы которой стремительно растут в последние несколько лет. ИППП вызываются различными микроорганизмами, возбудителями могут быть бактерии, вирусы и простейшие. Симптоматика болезней чаще проявляется в области половых органов, на слизистой рты, в виде кожной сыпи. Есть заболевания, передающиеся половым путем, которые поражают нашу лимфатическую и кровеносную системы. Они негативно влияют на внутренние органы и могут иметь серьезные последствия для здоровья, а если их своевременно не лечить, они могут значительно повысить вероятность заражения ВИЧ.

Как передаются ИППП?

Эти виды заболеваний передаются в основном при оральном, анальном и вагинальном сексе без презерватива. Некоторые заболевания, передающиеся половым путем (ВИЧ, гепатит B и C), передаются только при обмене жидкостями организма, такими как выделения из уретры, сперма или кровь инфицированного человека.

Другие ИППП могут передаваться через контакт с кожей или слизистой оболочкой пораженной кожи. К таким заболеваниям относятся гонорея, хламидиоз,  генитальный герпес.

Любые тревожные изменения требуют немедленной диагностики и сдачи анализов на ИППП. Общие симптомы инфекций, передающихся половым путем, у мужчин:

  • гнойные или слизисто-гнойные выделения из уретры
  • дискомфорт / боль / жжение при мочеиспускании
  • боль в яичках
  • язвы в области половых органов
  • боль внизу живота
  • боль во время полового акта
  • макулярная и макулопапулезная сыпь на коже тела, конечностей или на внутренней стороне рук и ног

Общие симптомы ИППП у женщин, требующие скорейшей сдачи анализов:

  • гнойные или слизисто-гнойные выделения из влагалища
  • дискомфорт / боль / жжение при мочеиспускании
  • измененные выделения из влагалища и / или запах и зуд
  • изъязвление в области гениталий
  • кровотечение между менструациями / после полового акта
  • боль во время полового акта
  • кожная сыпь

Диагностика ИППП

Диагностическое отделение Многопрофильного медицинского центра Клиника №1 предлагает всем сексуально активным людям пройти комплексное обследование на 12 венерических инфекций. Независимо от того, используете вы защитные меры или нет, регулярное прохождение диагностики рекомендовано всем, ведь  презерватив снижает риск заражения ИППП, но не устраняет его полностью.  Комплекс включает ПЦР диагностику на следующие ИППП:

  • Candida albicans, (возбудитель молочницы)
  • Chlamydia trachomatis (хламидия)
  • Gardnerella vaginalis
  • Mycoplasma genitalium
  • Mycoplasma hominis
  • Neisseria gonorrhoeae
  • Trichomonas vaginalis (трихомонада)
  • Ureaplasma spp
  • Вирус простого герпеса (HSV/ВПГ) тип 1,2,
  • Вирусы папилломы человека (ВПЧ, HPV) тип 16 и 18
  • Цитомегаловирус (CMV/ЦМВ)

Важно: анализы на сифилис и СПИД не входят в пакетное предложение по диагностике 12 ИППП, так как для их проведения метод ПЦР не применяется!

Для диагностики мужчинам необходимо сдать урогенитальный соскоб, женщинам – вагинальный соскоб (берется в гинекологическом кресле). Опытные лаборанты нашего диагностического отделения выполняют забор материала с максимальной аккуратностью, пациент не чувствует при этом даже малейшего дискомфорта. Узнать больше о том, как пройти ПЦР диагностику на 12 ИППП, и какая подготовка необходима, вы можете, обратившись к нам по телефону +7 499 322-00-98.

Запись на прием

Мы перезвоним вам
в ближайшее время

Контакты

Адрес:

г. Химки, ул. Московская, д.14, этаж 3

Время работы:

Пн-Пт 8:00-21:00, Сб 8:00-20:00,
Вс 9:00-20:00

КОМПЛЕКСНЫЕ ИССЛЕДОВАНИЯ МЕТОДОМ ПЦР (12 инфекций)

Инфекции, передающиеся при половом контакте, или ИППП (чаще их называют венерическими заболеваниями), переносятся от одного полового партнера другому при незащищенном половом акте. Возбудителями таких заболеваний могут быть: вирусы, бактерии, грибки или простейшие. К вирусным заболеваниям относят: ЦМВ, герпес, папилломатоз и кондиломатоз; грибковые заболевания — кандидоз; бактериальные — гонорея, или провоцируются простейшими микроорганизмами уреаплазмоз, микоплазмоз. Соответственно, лечение проводится под конкретного возбудителя.

Врачи дерматовенерологи все чаще наблюдают смешанную форму инфекций в таких случаях применяют комбинированное лечение. В число половых инфекций попадают заболевания, проникающие в человеческий организм извне, от зараженного партнера, и те, возбудители которых в обычном состоянии постоянно обитают на нашей коже и слизистых оболочках, не нанося никакого вреда. Эти микроорганизмы называются условно-патогенной флорой. Пока организм здоров, а иммунитет противостоит натиску инфекции и поддерживает численность микроорганизмов на низком, неопасном уровне, заболевания не возникает. Но при половом контакте с носителем такой же флоры или при снижении иммунитета численность возбудителей резко возрастает и человек заболевает. К числу таких болезней можно отнести всем хорошо известную молочницу, или кандидоз. Ее возбудители постоянно есть в организме каждого человека, но заболевание возникает лишь при совпадении ряда условий. Некоторые возбудителей венерических заболеваний достаточно хорошо поддается лечению современными препаратами, но делать это лучше как можно раньше, пока инфекция не вызвала серьезные воспалительные процессы. В результате могут возникнуть спайки, угрожающие женщине бесплодием, мужчине — поражением простаты, неприятные внешние высыпания и даже онкологические опухоли. Есть некоторые ИППП, которые в запущенном состоянии приводят к летальному исходу. Чтобы узнать, какое заболевание, входящее в ИППП список, имеется у пациента, врач дерматовенеролог проводит целый комплекс анализов. Для определения возбудителя у больного берет мазок и кровь. Диагностика чаще всего включает в себя следующие пробы: анализ крови на микрофлору, бактериологический посев, иммунологическая проба крови, ПИФ — метод, ПЦР — исследование. В сложных случаях приходится использовать сразу несколько методов определения причины болезни. Лечение ИППП должно происходить у обоих партнеров одновременно, чем быстрее после возникновения первых проявлений инфекции пациент обратится к врачу, тем больше у него шансов полностью избавиться от заболевания. В полной мере это относится к бактериальным инфекциям, с которыми отлично справляются современные антибиотики.

Анализ ПЦР — точная диагностика инфекций

Полимеразная цепная реакция (Polymerase chain reaction, ПЦР, PCR) – искусственный процесс, в ходе которого многократно копируются определенные участки ДНК (РНК). Метод изобрёл в 1983 году американский биохимик Кэри Б. Мюллис. В 1993 году за это открытие он был удостоен Нобелевской премии.

Области применения ПЦР чрезвычайно широки. Особое место ПЦР занимает в медицинской практике. И причина этому проста: полимеразная цепная реакция делает невозможное возможным.

Диагностику ПЦР образно описывают как метод, с помощью которого можно находить иглу в стоге сена и затем строить стог из этих игл. «Иглой» является крошечный фрагмент генетического материала клеток (ДНК или РНК).

Открытие этого метода – выдающееся событие в области молекулярной биологии за последние десятилетия. Развитие метода ПЦР позволило медицинской диагностике подняться на качественно новый уровень.

Основы ПЦР

Основа метода — многократное избирательное копирование (амплификация) определённого участка ДНК с целью получения такого количества генетического материала, которого будет достаточно для визуального обнаружения. При этом многократно копируется только заданный участок ДНК при условии, что он присутствует в исследуемом биоматериале.

Кроме того, исследование позволяет проводить другие манипуляции с генетическим материалом. Поэтому метод широко применяется в научных исследованиях, биологической и медицинской практике: в диагностике инфекционных и наследственных заболеваний, при выявлении мутаций, генотипировании, установлении отцовства, идентификации личности и др.

ПЦР в диагностике инфекционных болезней

Сегодня ПЦР-диагностика инфекций — один из самых точных, чувствительных и эффективных клинических лабораторных методов. Спектр выявляемых возбудителей практически неограничен – была бы разработана тест-система для анализа искомого возбудителя.

Благодаря своей высокой чувствительности, ПЦР позволяет выявить возбудителя даже при его минимальном содержании (то есть, когда в исследуемом биоматериале присутствуют всего несколько молекул его ДНК).

ПЦР выявляет возбудителей инфекционных заболеваний тогда, когда это невозможно сделать другими методами (иммунологическими, культуральными, микроскопическими). Поэтому для целого ряда возбудителей инфекций метод полимеразной цепной реакции стал «золотым стандартом», он проверен временем и одобрен клинически. Этот метод позволяет не только установить этиологию заболевания, но и контролировать течение инфекционного процесса и оценивать эффективность проводимого лечения.

Анализ методом ПЦР особенно актуален при бессимптомном течении инфекционного процесса, вызванного безусловно-патогенными микроорганизмами — возбудителями инфекций, передаваемых половым путём (Хламидия, качественное определение ДНК; Микоплазма, качественное определение ДНКВозбудитель гонореи, качественное определение ДНК;  Возбудитель трихомоноза, качественное определение ДНК). Например, при хронической гонорее у женщин даже с помощью бактериологического метода часто не удается выявить гонококк, несмотря на имеющиеся симптомы хронического воспалительного процесса в шейке матки или уретре.

Современная ПЦР-диагностика позволяет не только выявить факт наличия генетического материала возбудителя инфекции, но и определить его количество. Определение количества возбудителей важно для принятия решения о лечении, его способах и длительности, особенно если выявлены условно-патогенные микроорганизмы (Микоплазма, количественное определение ДНКТипирование уреаплазмы, количественное определение ДНК).

В лаборатории CMD разработан формат ПЦР исследования «Мультипрайм», позволяющий выявить в одной пробирке (и одной реакции) нескольких патогенов.

ПЦР-диагностика гепатитов

Известно как минимум 5 вирусов, которые способны вызывать поражение печени — возбудители гепатита А, В, С, D, Е. В редких случаях гепатит может быть вызван вирусами Эпштейна-Барр и простого герпеса. Все эти вирусы относятся к различным семействам, имеют разные биологические свойства и соответственно, тактика лечения будет тоже значительно отличаться.

Быстро и точно определить возбудителя – первоочередная задача врача. Без использования современных молекулярно-биологических методов это невозможно. Поэтому диагностика гепатитов методом полимеразной цепной реакции – важный шаг в установлении причины заболевания и определения дальнейшей тактики лечения.

ПЦР в диагностике ВИЧ-инфекции

Для выявления ВИЧ-инфекции в условиях лаборатории используется серологическая диагностика — обнаружение в крови антител к ВИЧ с помощью иммуноферментного анализа (ИФА). Затем следует подтверждение положительных результатов анализа методом иммуноблоттинга (ИБ). Эффективность данного подхода достигает 99% и более.

Но серологическая диагностика ВИЧ-инфекции имеет ряд ограничений:

  1. Неэффективность в период «серологического окна» (в первые недели после заражения антитела не выявляются по причине их отсутствия или низкой концентрации).
  2. Антитела к ВИЧ длительное время выявляются у всех детей, рожденных от ВИЧ-инфицированных матерей.
  3. Ложноположительные результаты ИФА из-за присутствия в крови антител к антигенам, сходным с антигенами ВИЧ.
  4. Ложноотрицательные и сомнительные результаты ИФА и иммуноблоттинга (особенно у пациентов в терминальной стадии заболевания).

Поэтому анализы ПЦР при обследовании на ВИЧ-инфекцию сегодня находят всё более широкое применение. В «Методических рекомендациях о проведении обследования на ВИЧ-инфекцию» сказано: «при наличии эпидемиологических критериев, свидетельствующих о недавнем риске заражения ВИЧ для пациентов и при этом предположительно ложноположительных или ложноотрицательных результатов ИФА и ИБ, например, при обследовании детей, рожденных от ВИЧ-инфицированных матерей, или пациентов в периоде «серологического окна», используется метод ПЦР, при котором обнаруживается генный материал ВИЧ». А в случае уже установленного диагноза ВИЧ-инфекции анализ методом ПЦР используется для прогноза, динамического наблюдения и мониторинга проводимой терапии.

В Центре молекулярной диагностики (CMD) можно сдать ПЦР-анализ на ВИЧ анонимно.

Где сдать анализ методом ПЦР?

Вы можете сдать анализ методом ПЦР в офисе CMD, обратитесь к разделу сайта «Где сдать анализы».

Анализ ПЦР в Одинцово и Звенигороде: сдать анализы ПЦР на 12 инфекций

Анализ ПЦР на инфекции

При диагностике многократно копируются частицы ДНК возбудителя, что позволяет специалисту увеличить элементы генетического материала и определить его присутствие в биоматериале человека. Выявить вирусы при помощи данного метода можно на разных стадиях, в том числе – в «спящем» состоянии, когда они не проявляются симптомами. Анализ ПЦР на инфекции помогает выявить:
  • вирус папилломы человека;
  • гонорею;
  • хламидию;
  • микоплазму;
  • трихомонаду;
  • кандидоз;
  • уреаплазму;
  • гарднереллу;
  • герпес;
  • цитомегаловирус;
  • вирус Эпштейна-Барра;
  • туберкулез;
  • гепатит А, В и С;
  • ВИЧ;
  • хеликобактерии;
  • боррелиоз (возбудитель клещевого энцефалита).
Часто назначается анализ ПЦР-6, выявляющий наличие хламидий, гарднерелл, трихомонад, уреаплазмы, микоплазмы hominis и genitalium. 

Как проводится анализ?

Врач определяет область взятия биоматериала в зависимости от локализации и типа заболевания. Материалом для исследования может служить любая ткань, биологическая жидкость человеческого организма: слюна, моча, кровь, секрет половых органов, мокрота и прочие.

При диагностике основных половых инфекций чаще берут мазок, для определения гепатита B, C, D, G методом ПЦР – кровь. Также анализ крови берут при подозрении на ВИЧ.

У мужчин взятие мазка из уретры может сопровождаться болевыми ощущениями. Насколько они будут выраженными, зависит от индивидуальной чувствительности организма и навыков специалиста, производящего забор биоматериала. 

Расшифровка анализа ПЦР может показать положительный или отрицательный результат. При отсутствии инфекций он будет отрицательным, положительный говорит о наличии микроорганизмов, но это могут быть и условно-патогенные микробы. В любом случае расшифровкой анализа ПЦР и назначением лечения должен заниматься доктор.

Почему в «ВЕРАМЕД»?

Высококвалифицированные специалисты наших медицинских центров проведут необходимую подготовку – консультации, рекомендации по сдаче анализов, забор биоматериала, который подвергнется исследованию в том числе в собственной лаборатории «ВЕРАМЕД». После процедуры пациент получит результаты и их расшифровку.  Анализы ПЦР (на 12 инфекций, диагностика слюны, мочи, мокроты и другого биоматериала) недорого вы можете сдать в наших клиниках ежедневно. Дополнительную информацию уточняйте в кол-центре: 8 (495)150-03-03.
Перечень оказываемых медицинскими центрами в Одинцово и Звенигороде услуг, как и цена каждого исследования, и отзывы о специалистах доступны на нашем сайте. 


Обнаружение 12 респираторных вирусных инфекций в режиме реального времени с помощью ОТ-ПЦР в четырех триплексных реакциях

J Clin Virol. 2005 Aug; 33 (4): 341–344.

Западно-Шотландский специализированный центр вирусологии, больница общего профиля Гартнавел, Грейт Вестерн Роуд, Глазго, G12 OYN, Великобритания

Получено 13 октября 2004 г .; Принято 29 ноября 2004 г.

Copyright © 2005 Elsevier B.V. Все права защищены.

С января 2020 года компания Elsevier создала ресурсный центр COVID-19 с бесплатной информацией на английском и китайском языках о новом коронавирусе COVID-19.Ресурсный центр COVID-19 размещен на сайте публичных новостей и информации компании Elsevier Connect. Elsevier настоящим разрешает сделать все свои исследования, связанные с COVID-19, которые доступны в ресурсном центре COVID-19, включая этот исследовательский контент, сразу же в PubMed Central и других финансируемых государством репозиториях, таких как база данных COVID ВОЗ с правами на неограниченное исследование, повторное использование и анализ в любой форме и любыми средствами с указанием первоисточника.Эти разрешения предоставляются Elsevier бесплатно до тех пор, пока ресурсный центр COVID-19 остается активным.

Эта статья цитируется в других статьях в PMC.

1. Введение

Традиционная вирусная культура, обычно в сочетании с прямой иммунофлюоресценцией (DIF), является золотым стандартом для лабораторной диагностики респираторных вирусных инфекций. Однако эти методы малочувствительны, трудоемки, имеют длительное время обработки и не могут обнаружить все известные вирусные респираторные патогены.ПЦР более чувствительна и специфична, чем традиционные методы, и может использоваться для обнаружения требовательных вирусов. ПЦР в реальном времени по крайней мере так же чувствительна, как и протоколы вложенной ПЦР на основе геля, и обеспечивает повышенную скорость (результаты доступны в течение рабочего дня). Использование специальных маркированных зондов обеспечивает легкую интерпретацию при использовании в мультиплексном формате. Мы описываем четыре метода ОТ-ПЦР на основе триплексной TaqMan ™, адаптированные из опубликованных методов и доработанные внутри компании для диагностики 12 вирусных респираторных патогенов.

2. Выбор праймеров и зондов

Праймеры и зонды для каждого триплекса описаны полностью ( ). Анализы ОТ-ПЦР в реальном времени для метапневмовируса человека (hMPV) ( Mackay et al., 2003 ), RSV A и B ( van Elden et al., 2003 ) и коронавируса 229E и OC43 ( van Elden et al. al., 2004 ) были опубликованы ранее. Хотя праймеры для обнаружения гриппа A и гриппа B, риновируса и парагриппа 1 и 2 были взяты из ранее опубликованных методов ( Bredius et al., 2004 , Templeton et al., 2004 ), зонды TaqMan ™ для этих патогенов были адаптированы из исходных молекулярных маяков. Для коронавируса NL63 и парагриппа 3 были разработаны собственные методы ОТ-ПЦР в реальном времени с использованием Beacon Designer 2.0 (Premier Biosoft International) и Primer Express (Applied Biosystems). Консервативные целевые области были идентифицированы с помощью BLAST (www.ncbi.nlm.nih.gov/blast). Для коронавируса NL63 и парагриппа 3 были выбраны области в генах 1a и гемаглуттинина соответственно.Было показано, что праймеры и зонды обнаруживают все представленные последовательности NL63 и парагриппа 3. При использовании алгоритма mfold (www.bioinfo.rpi.edu) мешающие вторичные структуры не наблюдались.

Таблица 1

Праймеры и зонды, используемые в анализах триплексной ОТ-ПЦР в реальном времени

900GA RSACATCATAATTAGGAG (250) 900GA (1000) 900GA 900ovGirus AGAC CCGQGCTGATGCA (1000) CCGGGCTGATGCA (1000) CCGQGCTGATGCA (1000) CCGQGCTGATGCA (1000)
Триплекс Патоген Последовательности праймеров (концентрация в нМ) Последовательность зонда (концентрация в нМ) Цель
1 Грипп A AAAGCGAATTTCAGTGTGAT (1000) 6FAM-CCC TCT TCG GTG AAA GCC CT-BHQ (300) NS1 ген
T GAAGGAT
Грипп B GTCCATCAAGCTCCAGTTTT (1000) CY5-CCTCCGTCTCCACCTACT TCGTT-BHQ (300) Ген нуклеопротеина
TCGTT-BHQ (300) Нуклеопротеиновый ген
Метапневмовирус человека AACCGT GTACTAAGTGATGCACTC (500) VIC-CTTTGCCATACTCAATGAACAAAC-TAMRA (300) Ген нуклеокапсидного белка
CATTGTTTGACCGGCCCCATAA (500) AGATCAACTTCTGTCATCCAGCAA (1000) 6FAM-CACCATCCAACGGAGCACAGGAGAT-BHQ (300) Ген нуклеокапсидного белка
TTCTGCACATCATAATTAGGAG (250) CY5-TTTCCCTTCCTAACCTGGACATA-BHQ (300)
TGATATCCAGCATCTTTAAGTA (1000)
VIC-TCCTCCG GCCCCTGAATG-TAMRA (300) Пять непереведенных областей
CAAAGTAGTCGGTCCCATCC (1000)
3 ACCTAC ACCTAC ACCTAAC5 ACCTAAC5 900AAC 9000AAC CAAACGATGGCTGAAAAAGGGA-BHQ (300) Ген HN
CTTCCTGCTGGTGTGTTAAT (500)
CCTACGAT
CCTACT CCTACGT 2 CCTACT TAMRA (300) Ген HN
CGTGGCATAATCTTCTTTTT (1000)
Parainlfuenza 3- CCAGGGATGATAYTAYACCA CCAGGGATGATAYTAYA 300) HN г ene
CCGGGRCACCCAGTTGTG (1000)
4 Коронвирус 229E CAGTCAAATGGQGCTGATGCA (1000)
AAAGGGCTATAAAGAGAATAAGGTATTCT (1000)
Коронавирус OC43 CGATGAGGCTATTCCGACTGACTGACT (125) GCTATTCCGACTGACTGACT (125) GCTATTCCGACTGACTGACT (125) GCCY5
CCTTCCTGAGCCTTCAATATAGTAACC (1000)
Коронавирус NL63 ACGTACTTCTATTATGAAGCATGATATTAA (1000) VIC -GCT52 VIC -GCTGCCAACAA (1000) VIC -GCTGCCAAG 051 AGCAGATCTAATGTTATACTTAAAACTACG (1000)

3.Выбор флуофоров

Все анализы ОТ-ПЦР в реальном времени были разработаны для использования в системе ПЦР в реальном времени ABI 7500. Для мультиплексной ПЦР в реальном времени ABI рекомендует маркировать зонды красителями FAM и VIC, поскольку они отличаются друг от друга, поскольку имеют разные максимумы длины волны излучения (518 нм и 554 нм). Мы выбрали CY5 в качестве третьего красителя, так как его максимумы длины волны излучения удалены как от FAM, так и от VIC (670 нм). Перекрестных помех не наблюдалось.

4. Протокол

Респираторные контроли и образцы были извлечены с использованием мини-набора крови Qiagen на Biorobot 9604 с использованием стандартных протоколов.Амплификацию проводили в реакционном объеме 25 мкл с использованием одностадийной системы q-RT-PCR Invitrogen с надстрочным индексом III, содержащей 10 мкл экстрагированного образца. Праймеры и зонды добавляли к каждой реакции ПЦР в указанной концентрации (). Обратную транскрипцию проводили в течение 15 мин при 50 ° C. Полимераза Platinum taq была активирована при 95 ° C в течение 2 минут, и 40 циклов ПЦР выполнялись при 95 ° C в течение 8 секунд и 60 ° C в течение 34 секунд с использованием ABI 7500 SDS. Общее время реакции на триплексную реакцию составляло приблизительно 75 мин.

5. Аналитическая чувствительность

Все анализы ПЦР в реальном времени были ранее оценены в их исходных форматах с одной мишенью или дуплексом с использованием панелей известных культур и DIF или вложенных ПЦР-положительных и отрицательных образцов. Все анализы ОТ-ПЦР в реальном времени были более чувствительными, чем традиционные или вложенные методы ОТ-ПЦР (данные не показаны). Все анализы ОТ-ПЦР в реальном времени (кроме коронавируса NL63 и парагриппа 2) также оценивались с помощью респираторной панели молекулярной диагностики контроля качества (QCMD) ( Forde et al., в печати ). Каждый тест ОТ-ПЦР в реальном времени обнаруживал соответствующую мишень при соответствующем разбавлении конечной точки.

6. Чувствительность по сравнению с существующими методами диагностики

Четыре мультиплексных анализа RT-PCR в реальном времени были разработаны для одновременного обнаружения

  • 1.

    гриппа A, гриппа B и hMPV;

  • 2.

    RSV A, RSV B и риновирус;

  • 3.

    парагрипп 1, 2 и 3;

  • 4.

    коронавирус 229E, OC43 и NL63.

Каждый триплексный анализ ОТ-ПЦР в реальном времени первоначально оценивался с использованием положительных контролей и сравнивался с предыдущим дублирующим или одиночным целевым форматом. Затем триплексные анализы сравнивали с панелями тканевых культур и положительными образцами DIF и / или вложенными ОТ-ПЦР (при наличии). Чтобы определить, будут ли смешанные инфекции снижать конечную точку триплексной чувствительности, разведения каждой вирусной мишени были протестированы как для одной мишени, так и для объединенной мишени (содержащей 10 различных вирусных мишеней при одном и том же разведении конечной точки).

6.1. Мультиплексная ОТ-ПЦР в реальном времени для метапневмовируса гриппа A, гриппа B и человека

Положительные контрольные образцы на грипп A, грипп B и hMPV были протестированы в трех лунках с использованием триплексного анализа параллельно с предыдущим дуплексным или одиночным целевым форматом ( ). Между методами не было значительной потери чувствительности (о чем свидетельствует порог цикла (Ct)). Затем триплексный анализ был протестирован на 11 образцах, положительных на грипп А. Триплексный анализ обнаружил все предыдущие положительные образцы.Конечное разведение как одиночных целевых контролей, так и объединенных контролей формата было обнаружено с помощью триплексного анализа, показывающего, что «смешанные инфекции» не снизят чувствительность этого анализа.

Таблица 2

Сравнение Ct положительных контролей в трех повторах для вируса гриппа A, гриппа B и HmPv в одинарной, дуплексной и тройной реакции RT-PCR

Среднее значение Ct (± SEM)
Flu A в дуплексном режиме 29.91 (0,1)
Flu A в триплексе 30,46 (0,32)
Flu B в дуплексе 25,90 (0,21)
Flu B в триплексе 26,22 (0,53)
hMPV в одиночном 29,83 (0,38)
hMPV в триплексном 28,93 (0,18)

6.2. Мультиплексная ОТ-ПЦР в реальном времени для RSV A, RSV B и риновируса

Положительные образцы на RSV A, RSV B и риновирус были протестированы в триплексном формате в трех экземплярах и сравнивались с дуплексным или одиночным целевым форматом ( ).Для RSV A и RSV B не наблюдалось потери чувствительности. Чувствительность RT-PCR риновируса в реальном времени улучшалась при включении в триплексный анализ (как показано снижением Ct). Это повышение чувствительности было специфичным для образца (происходило только с положительным контролем), поскольку при тестировании образцов с положительным риновирусом не наблюдалось снижения Ct. Затем триплексный анализ оценивали на 42 образцах, положительных по RSV (образцы NPA, положительные с помощью DIF и гнездовой ПЦР на основе геля), и 11 образцах, положительных по риновирусу.Триплексный анализ обнаружил все ранее положительные образцы. Конечное разведение как одиночных целевых контролей для RSV A, RSV B и риновируса, так и объединенных контролей формата (содержащих 10 вирусных мишеней) было обнаружено с помощью триплексного анализа, показывающего, что «смешанные инфекции» не снизят чувствительность этого анализа.

Таблица 3

Сравнение Ct для RSV A, RSV B и риновируса в одинарных, дуплексных и триплексных реакциях RT-PCR

Среднее значение Ct (± S.ME)
RSV A дуплекс 17,43 (0,28)
RSV A триплекс 17,19 (0,15)
RSV B дуплекс 22,06 (0,22)
RSV B триплекс 21,17 (0,28)
Rhino single 26,05 (0,13)
Rhino triplex 23,85 (0,02)

6.3. Мультиплексная ОТ-ПЦР в реальном времени для парагриппа 1, 2 и 3

Положительные контрольные образцы на парагрипп 1, 2 и 3 были протестированы в формате триплекс, либо с новым анализом PF3, либо с исходным тестом.Внедрение нового анализа PF3 не повлияло на чувствительность анализов ОТ-ПЦР PF1 и PF2 ( ). Однако новая ОТ-ПЦР PF3 оказалась более чувствительной, чем предыдущий метод. Затем новый триплексный анализ сравнивали с опубликованным методом на 19 образцах, положительных по DIF PF3. Новый метод позволил выявить один дополнительный образец (19 против 18). Конечное разведение как одиночных целевых контролей, так и объединенных контролей формата было обнаружено с помощью триплексного анализа, показывающего, что «смешанные инфекции» не снизят чувствительность этого анализа.

Таблица 4

Сравнение опубликованного триплексного анализа парагриппа с триплексным анализом парагриппа, включающим новый анализ ОТ-ПЦР PF3

38
Ct контроля PF1 Ct контроля PF2 Ct контроля PF3
Опубликован триплексный анализ парагриппа 28,34 24,17 28,37
Опубликован триплексный анализ парагриппа с новым PF3 PCR 27.75 25,02 24,24

6.4. Мультиплексная ОТ-ПЦР в реальном времени на коронавирус 229E, OC43 и NL63

Положительные образцы на коронавирус 229E, OC43 и NL63 были протестированы в триплексном формате и в дуплексном или одиночном целевом формате ( ). Существенных изменений Ct не наблюдалось. Конечное разведение как одиночных целевых контролей, так и объединенных контролей формата было обнаружено с помощью триплексного анализа, показывающего, что «смешанные инфекции» не снизят чувствительность этого анализа.

Таблица 5

Сравнение Ct для одиночных, дуплексных и тройных анализов RT-PCR для конровирусов 229E, OC43 и NL63

26.23
Ct контроля OC43 Ct контроля 229E Ct NL63 контроль
Анализ OC34 / 229E / NL63 23,76 31,9 26,67
Анализ OC43 / 229E 23,63 31,3
NL63

Мы показали, что эти триплексные анализы ОТ-ПЦР в реальном времени, по крайней мере, столь же чувствительны, как и наши предыдущие анализы ОТ-ПЦР. Быстрота, стабильность и простота использования этих триплексных анализов ОТ-ПЦР в реальном времени позволяют сократить время цикла (12 патогенов в течение рабочего дня), упростить интерпретацию и повысить рентабельность. Внедрение этих тестов, несомненно, улучшит ведение пациентов, процедуры инфекционного контроля и эффективность систем эпиднадзора.

Ссылки

  • Bredius R.G., Templeton K.E., Scheltinga S.A., Claas E.C., Kroes A.C., Vossen J.M.Проспективное исследование респираторных вирусных инфекций у пациентов с трансплантацией гемопоэтических стволовых клеток у детей. Pediatr Infect Dis J. 2004; 23 (июнь (6)): 518–522. [PubMed] [Google Scholar]
  • Forde et al., Статья в печати.
  • Маккей И.М., Джейкоб К.С., Вулхаус Д., Уоллер К., Сирмис М.В., Уилли Д.М. Молекулярные анализы для обнаружения метапневмовируса человека.J Clin Microbiol. 2003; 41 (январь (1)): 100–105. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Templeton KE, Scheltinga SA, Beersma MF, Kroes AC, Claas EC Быстрый и чувствительный метод с использованием мультиплексной ПЦР в реальном времени для диагностики инфекций, вызываемых вирусами гриппа A и гриппа B, респираторно-синцитиальный вирус и вирусы парагриппа 1, 2, 3 и 4. J. Clin Microbiol. 2004; 42 (апрель (4)): 1564–1569. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • ван Элден Л.Дж., ван Лун А.М., ван Альфен Ф., Хендриксен К.А., Хёпельман А.И., ван Краай М.Г. Частое обнаружение коронавирусов человека в клинических образцах от пациентов с инфекцией дыхательных путей с помощью новой полимеразной цепной реакции с обратной транскриптазой в реальном времени. J Infect Dis. 2004; 189 (февраль (4)): 652–657. [Epub 2004, 28 января] [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • ван Элден Л.Дж., ван Лун А.М., ван дер Бик А., Хендриксен К.А., Хёпельман А.И., ван Краай М.Г. Применимость количественного анализа ПЦР в реальном времени для диагностики респираторно-синцитиальной вирусной инфекции у взрослых с ослабленным иммунитетом.J Clin Microbiol. 2003; 41 (сентябрь (9)): 4378–4381. [Бесплатная статья PMC] [PubMed] [Google Scholar]

Обнаружение 12 респираторных вирусных инфекций в режиме реального времени с помощью ОТ-ПЦР в четырех реакциях триплекс

J Clin Virol. 2005 Aug; 33 (4): 341–344.

Западно-Шотландский специализированный центр вирусологии, больница общего профиля Гартнавел, Грейт Вестерн Роуд, Глазго, G12 OYN, Великобритания

Получено 13 октября 2004 г .; Принято 29 ноября 2004 г.

Copyright © 2005 Elsevier B.V. Все права защищены.

С января 2020 года компания Elsevier создала ресурсный центр COVID-19 с бесплатной информацией на английском и китайском языках о новом коронавирусе COVID-19. Ресурсный центр COVID-19 размещен на сайте публичных новостей и информации компании Elsevier Connect. Elsevier настоящим разрешает сделать все свои исследования, связанные с COVID-19, которые доступны в ресурсном центре COVID-19, включая этот исследовательский контент, немедленно в PubMed Central и других финансируемых государством репозиториях, таких как база данных COVID ВОЗ с правами на неограниченное исследование, повторное использование и анализ в любой форме и любыми средствами с указанием первоисточника.Эти разрешения предоставляются Elsevier бесплатно до тех пор, пока ресурсный центр COVID-19 остается активным.

Эта статья цитируется в других статьях в PMC.

1. Введение

Традиционная вирусная культура, обычно в сочетании с прямой иммунофлюоресценцией (DIF), является золотым стандартом для лабораторной диагностики респираторных вирусных инфекций. Однако эти методы малочувствительны, трудоемки, имеют длительное время обработки и не могут обнаружить все известные вирусные респираторные патогены.ПЦР более чувствительна и специфична, чем традиционные методы, и может использоваться для обнаружения требовательных вирусов. ПЦР в реальном времени по крайней мере так же чувствительна, как и протоколы вложенной ПЦР на основе геля, и обеспечивает повышенную скорость (результаты доступны в течение рабочего дня). Использование специальных маркированных зондов обеспечивает легкую интерпретацию при использовании в мультиплексном формате. Мы описываем четыре метода ОТ-ПЦР на основе триплексной TaqMan ™, адаптированные из опубликованных методов и доработанные внутри компании для диагностики 12 вирусных респираторных патогенов.

2. Выбор праймеров и зондов

Праймеры и зонды для каждого триплекса описаны полностью ( ). Анализы ОТ-ПЦР в реальном времени для метапневмовируса человека (hMPV) ( Mackay et al., 2003 ), RSV A и B ( van Elden et al., 2003 ) и коронавируса 229E и OC43 ( van Elden et al. al., 2004 ) были опубликованы ранее. Хотя праймеры для обнаружения гриппа A и гриппа B, риновируса и парагриппа 1 и 2 были взяты из ранее опубликованных методов ( Bredius et al., 2004 , Templeton et al., 2004 ), зонды TaqMan ™ для этих патогенов были адаптированы из исходных молекулярных маяков. Для коронавируса NL63 и парагриппа 3 были разработаны собственные методы ОТ-ПЦР в реальном времени с использованием Beacon Designer 2.0 (Premier Biosoft International) и Primer Express (Applied Biosystems). Консервативные целевые области были идентифицированы с помощью BLAST (www.ncbi.nlm.nih.gov/blast). Для коронавируса NL63 и парагриппа 3 были выбраны области в генах 1a и гемаглуттинина соответственно.Было показано, что праймеры и зонды обнаруживают все представленные последовательности NL63 и парагриппа 3. При использовании алгоритма mfold (www.bioinfo.rpi.edu) мешающие вторичные структуры не наблюдались.

Таблица 1

Праймеры и зонды, используемые в анализах триплексной ОТ-ПЦР в реальном времени

900GA RSACATCATAATTAGGAG (250) 900GA (1000) 900GA 900ovGirus AGAC CCGQGCTGATGCA (1000) CCGGGCTGATGCA (1000) CCGQGCTGATGCA (1000) CCGQGCTGATGCA (1000)
Триплекс Патоген Последовательности праймеров (концентрация в нМ) Последовательность зонда (концентрация в нМ) Цель
1 Грипп A AAAGCGAATTTCAGTGTGAT (1000) 6FAM-CCC TCT TCG GTG AAA GCC CT-BHQ (300) NS1 ген
T GAAGGAT
Грипп B GTCCATCAAGCTCCAGTTTT (1000) CY5-CCTCCGTCTCCACCTACT TCGTT-BHQ (300) Ген нуклеопротеина
TCGTT-BHQ (300) Нуклеопротеиновый ген
Метапневмовирус человека AACCGT GTACTAAGTGATGCACTC (500) VIC-CTTTGCCATACTCAATGAACAAAC-TAMRA (300) Ген нуклеокапсидного белка
CATTGTTTGACCGGCCCCATAA (500) AGATCAACTTCTGTCATCCAGCAA (1000) 6FAM-CACCATCCAACGGAGCACAGGAGAT-BHQ (300) Ген нуклеокапсидного белка
TTCTGCACATCATAATTAGGAG (250) CY5-TTTCCCTTCCTAACCTGGACATA-BHQ (300)
TGATATCCAGCATCTTTAAGTA (1000)
VIC-TCCTCCG GCCCCTGAATG-TAMRA (300) Пять непереведенных областей
CAAAGTAGTCGGTCCCATCC (1000)
3 ACCTAC ACCTAC ACCTAAC5 ACCTAAC5 900AAC 9000AAC CAAACGATGGCTGAAAAAGGGA-BHQ (300) Ген HN
CTTCCTGCTGGTGTGTTAAT (500)
CCTACGAT
CCTACT CCTACGT 2 CCTACT TAMRA (300) Ген HN
CGTGGCATAATCTTCTTTTT (1000)
Parainlfuenza 3- CCAGGGATGATAYTAYACCA CCAGGGATGATAYTAYA 300) HN г ene
CCGGGRCACCCAGTTGTG (1000)
4 Коронвирус 229E CAGTCAAATGGQGCTGATGCA (1000)
AAAGGGCTATAAAGAGAATAAGGTATTCT (1000)
Коронавирус OC43 CGATGAGGCTATTCCGACTGACTGACT (125) GCTATTCCGACTGACTGACT (125) GCTATTCCGACTGACTGACT (125) GCCY5
CCTTCCTGAGCCTTCAATATAGTAACC (1000)
Коронавирус NL63 ACGTACTTCTATTATGAAGCATGATATTAA (1000) VIC -GCT52 VIC -GCTGCCAACAA (1000) VIC -GCTGCCAAG 051 AGCAGATCTAATGTTATACTTAAAACTACG (1000)

3.Выбор флуофоров

Все анализы ОТ-ПЦР в реальном времени были разработаны для использования в системе ПЦР в реальном времени ABI 7500. Для мультиплексной ПЦР в реальном времени ABI рекомендует маркировать зонды красителями FAM и VIC, поскольку они отличаются друг от друга, поскольку имеют разные максимумы длины волны излучения (518 нм и 554 нм). Мы выбрали CY5 в качестве третьего красителя, так как его максимумы длины волны излучения удалены как от FAM, так и от VIC (670 нм). Перекрестных помех не наблюдалось.

4. Протокол

Респираторные контроли и образцы были извлечены с использованием мини-набора крови Qiagen на Biorobot 9604 с использованием стандартных протоколов.Амплификацию проводили в реакционном объеме 25 мкл с использованием одностадийной системы q-RT-PCR Invitrogen с надстрочным индексом III, содержащей 10 мкл экстрагированного образца. Праймеры и зонды добавляли к каждой реакции ПЦР в указанной концентрации (). Обратную транскрипцию проводили в течение 15 мин при 50 ° C. Полимераза Platinum taq была активирована при 95 ° C в течение 2 минут, и 40 циклов ПЦР выполнялись при 95 ° C в течение 8 секунд и 60 ° C в течение 34 секунд с использованием ABI 7500 SDS. Общее время реакции на триплексную реакцию составляло приблизительно 75 мин.

5. Аналитическая чувствительность

Все анализы ПЦР в реальном времени были ранее оценены в их исходных форматах с одной мишенью или дуплексом с использованием панелей известных культур и DIF или вложенных ПЦР-положительных и отрицательных образцов. Все анализы ОТ-ПЦР в реальном времени были более чувствительными, чем традиционные или вложенные методы ОТ-ПЦР (данные не показаны). Все анализы ОТ-ПЦР в реальном времени (кроме коронавируса NL63 и парагриппа 2) также оценивались с помощью респираторной панели молекулярной диагностики контроля качества (QCMD) ( Forde et al., в печати ). Каждый тест ОТ-ПЦР в реальном времени обнаруживал соответствующую мишень при соответствующем разбавлении конечной точки.

6. Чувствительность по сравнению с существующими методами диагностики

Четыре мультиплексных анализа RT-PCR в реальном времени были разработаны для одновременного обнаружения

  • 1.

    гриппа A, гриппа B и hMPV;

  • 2.

    RSV A, RSV B и риновирус;

  • 3.

    парагрипп 1, 2 и 3;

  • 4.

    коронавирус 229E, OC43 и NL63.

Каждый триплексный анализ ОТ-ПЦР в реальном времени первоначально оценивался с использованием положительных контролей и сравнивался с предыдущим дублирующим или одиночным целевым форматом. Затем триплексные анализы сравнивали с панелями тканевых культур и положительными образцами DIF и / или вложенными ОТ-ПЦР (при наличии). Чтобы определить, будут ли смешанные инфекции снижать конечную точку триплексной чувствительности, разведения каждой вирусной мишени были протестированы как для одной мишени, так и для объединенной мишени (содержащей 10 различных вирусных мишеней при одном и том же разведении конечной точки).

6.1. Мультиплексная ОТ-ПЦР в реальном времени для метапневмовируса гриппа A, гриппа B и человека

Положительные контрольные образцы на грипп A, грипп B и hMPV были протестированы в трех лунках с использованием триплексного анализа параллельно с предыдущим дуплексным или одиночным целевым форматом ( ). Между методами не было значительной потери чувствительности (о чем свидетельствует порог цикла (Ct)). Затем триплексный анализ был протестирован на 11 образцах, положительных на грипп А. Триплексный анализ обнаружил все предыдущие положительные образцы.Конечное разведение как одиночных целевых контролей, так и объединенных контролей формата было обнаружено с помощью триплексного анализа, показывающего, что «смешанные инфекции» не снизят чувствительность этого анализа.

Таблица 2

Сравнение Ct положительных контролей в трех повторах для вируса гриппа A, гриппа B и HmPv в одинарной, дуплексной и тройной реакции RT-PCR

Среднее значение Ct (± SEM)
Flu A в дуплексном режиме 29.91 (0,1)
Flu A в триплексе 30,46 (0,32)
Flu B в дуплексе 25,90 (0,21)
Flu B в триплексе 26,22 (0,53)
hMPV в одиночном 29,83 (0,38)
hMPV в триплексном 28,93 (0,18)

6.2. Мультиплексная ОТ-ПЦР в реальном времени для RSV A, RSV B и риновируса

Положительные образцы на RSV A, RSV B и риновирус были протестированы в триплексном формате в трех экземплярах и сравнивались с дуплексным или одиночным целевым форматом ( ).Для RSV A и RSV B не наблюдалось потери чувствительности. Чувствительность RT-PCR риновируса в реальном времени улучшалась при включении в триплексный анализ (как показано снижением Ct). Это повышение чувствительности было специфичным для образца (происходило только с положительным контролем), поскольку при тестировании образцов с положительным риновирусом не наблюдалось снижения Ct. Затем триплексный анализ оценивали на 42 образцах, положительных по RSV (образцы NPA, положительные с помощью DIF и гнездовой ПЦР на основе геля), и 11 образцах, положительных по риновирусу.Триплексный анализ обнаружил все ранее положительные образцы. Конечное разведение как одиночных целевых контролей для RSV A, RSV B и риновируса, так и объединенных контролей формата (содержащих 10 вирусных мишеней) было обнаружено с помощью триплексного анализа, показывающего, что «смешанные инфекции» не снизят чувствительность этого анализа.

Таблица 3

Сравнение Ct для RSV A, RSV B и риновируса в одинарных, дуплексных и триплексных реакциях RT-PCR

Среднее значение Ct (± S.ME)
RSV A дуплекс 17,43 (0,28)
RSV A триплекс 17,19 (0,15)
RSV B дуплекс 22,06 (0,22)
RSV B триплекс 21,17 (0,28)
Rhino single 26,05 (0,13)
Rhino triplex 23,85 (0,02)

6.3. Мультиплексная ОТ-ПЦР в реальном времени для парагриппа 1, 2 и 3

Положительные контрольные образцы на парагрипп 1, 2 и 3 были протестированы в формате триплекс, либо с новым анализом PF3, либо с исходным тестом.Внедрение нового анализа PF3 не повлияло на чувствительность анализов ОТ-ПЦР PF1 и PF2 ( ). Однако новая ОТ-ПЦР PF3 оказалась более чувствительной, чем предыдущий метод. Затем новый триплексный анализ сравнивали с опубликованным методом на 19 образцах, положительных по DIF PF3. Новый метод позволил выявить один дополнительный образец (19 против 18). Конечное разведение как одиночных целевых контролей, так и объединенных контролей формата было обнаружено с помощью триплексного анализа, показывающего, что «смешанные инфекции» не снизят чувствительность этого анализа.

Таблица 4

Сравнение опубликованного триплексного анализа парагриппа с триплексным анализом парагриппа, включающим новый анализ ОТ-ПЦР PF3

38
Ct контроля PF1 Ct контроля PF2 Ct контроля PF3
Опубликован триплексный анализ парагриппа 28,34 24,17 28,37
Опубликован триплексный анализ парагриппа с новым PF3 PCR 27.75 25,02 24,24

6.4. Мультиплексная ОТ-ПЦР в реальном времени на коронавирус 229E, OC43 и NL63

Положительные образцы на коронавирус 229E, OC43 и NL63 были протестированы в триплексном формате и в дуплексном или одиночном целевом формате ( ). Существенных изменений Ct не наблюдалось. Конечное разведение как одиночных целевых контролей, так и объединенных контролей формата было обнаружено с помощью триплексного анализа, показывающего, что «смешанные инфекции» не снизят чувствительность этого анализа.

Таблица 5

Сравнение Ct для одиночных, дуплексных и тройных анализов RT-PCR для конровирусов 229E, OC43 и NL63

26.23
Ct контроля OC43 Ct контроля 229E Ct NL63 контроль
Анализ OC34 / 229E / NL63 23,76 31,9 26,67
Анализ OC43 / 229E 23,63 31,3
NL63

Мы показали, что эти триплексные анализы ОТ-ПЦР в реальном времени, по крайней мере, столь же чувствительны, как и наши предыдущие анализы ОТ-ПЦР. Быстрота, стабильность и простота использования этих триплексных анализов ОТ-ПЦР в реальном времени позволяют сократить время цикла (12 патогенов в течение рабочего дня), упростить интерпретацию и повысить рентабельность. Внедрение этих тестов, несомненно, улучшит ведение пациентов, процедуры инфекционного контроля и эффективность систем эпиднадзора.

Ссылки

  • Bredius R.G., Templeton K.E., Scheltinga S.A., Claas E.C., Kroes A.C., Vossen J.M.Проспективное исследование респираторных вирусных инфекций у пациентов с трансплантацией гемопоэтических стволовых клеток у детей. Pediatr Infect Dis J. 2004; 23 (июнь (6)): 518–522. [PubMed] [Google Scholar]
  • Forde et al., Статья в печати.
  • Маккей И.М., Джейкоб К.С., Вулхаус Д., Уоллер К., Сирмис М.В., Уилли Д.М. Молекулярные анализы для обнаружения метапневмовируса человека.J Clin Microbiol. 2003; 41 (январь (1)): 100–105. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Templeton KE, Scheltinga SA, Beersma MF, Kroes AC, Claas EC Быстрый и чувствительный метод с использованием мультиплексной ПЦР в реальном времени для диагностики инфекций, вызываемых вирусами гриппа A и гриппа B, респираторно-синцитиальный вирус и вирусы парагриппа 1, 2, 3 и 4. J. Clin Microbiol. 2004; 42 (апрель (4)): 1564–1569. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • ван Элден Л.Дж., ван Лун А.М., ван Альфен Ф., Хендриксен К.А., Хёпельман А.И., ван Краай М.Г. Частое обнаружение коронавирусов человека в клинических образцах от пациентов с инфекцией дыхательных путей с помощью новой полимеразной цепной реакции с обратной транскриптазой в реальном времени. J Infect Dis. 2004; 189 (февраль (4)): 652–657. [Epub 2004, 28 января] [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • ван Элден Л.Дж., ван Лун А.М., ван дер Бик А., Хендриксен К.А., Хёпельман А.И., ван Краай М.Г. Применимость количественного анализа ПЦР в реальном времени для диагностики респираторно-синцитиальной вирусной инфекции у взрослых с ослабленным иммунитетом.J Clin Microbiol. 2003; 41 (сентябрь (9)): 4378–4381. [Бесплатная статья PMC] [PubMed] [Google Scholar]

Обнаружение 12 респираторных вирусных инфекций в режиме реального времени с помощью ОТ-ПЦР в четырех реакциях триплекс

J Clin Virol. 2005 Aug; 33 (4): 341–344.

Западно-Шотландский специализированный центр вирусологии, больница общего профиля Гартнавел, Грейт Вестерн Роуд, Глазго, G12 OYN, Великобритания

Получено 13 октября 2004 г .; Принято 29 ноября 2004 г.

Copyright © 2005 Elsevier B.V. Все права защищены.

С января 2020 года компания Elsevier создала ресурсный центр COVID-19 с бесплатной информацией на английском и китайском языках о новом коронавирусе COVID-19. Ресурсный центр COVID-19 размещен на сайте публичных новостей и информации компании Elsevier Connect. Elsevier настоящим разрешает сделать все свои исследования, связанные с COVID-19, которые доступны в ресурсном центре COVID-19, включая этот исследовательский контент, немедленно в PubMed Central и других финансируемых государством репозиториях, таких как база данных COVID ВОЗ с правами на неограниченное исследование, повторное использование и анализ в любой форме и любыми средствами с указанием первоисточника.Эти разрешения предоставляются Elsevier бесплатно до тех пор, пока ресурсный центр COVID-19 остается активным.

Эта статья цитируется в других статьях в PMC.

1. Введение

Традиционная вирусная культура, обычно в сочетании с прямой иммунофлюоресценцией (DIF), является золотым стандартом для лабораторной диагностики респираторных вирусных инфекций. Однако эти методы малочувствительны, трудоемки, имеют длительное время обработки и не могут обнаружить все известные вирусные респираторные патогены.ПЦР более чувствительна и специфична, чем традиционные методы, и может использоваться для обнаружения требовательных вирусов. ПЦР в реальном времени по крайней мере так же чувствительна, как и протоколы вложенной ПЦР на основе геля, и обеспечивает повышенную скорость (результаты доступны в течение рабочего дня). Использование специальных маркированных зондов обеспечивает легкую интерпретацию при использовании в мультиплексном формате. Мы описываем четыре метода ОТ-ПЦР на основе триплексной TaqMan ™, адаптированные из опубликованных методов и доработанные внутри компании для диагностики 12 вирусных респираторных патогенов.

2. Выбор праймеров и зондов

Праймеры и зонды для каждого триплекса описаны полностью ( ). Анализы ОТ-ПЦР в реальном времени для метапневмовируса человека (hMPV) ( Mackay et al., 2003 ), RSV A и B ( van Elden et al., 2003 ) и коронавируса 229E и OC43 ( van Elden et al. al., 2004 ) были опубликованы ранее. Хотя праймеры для обнаружения гриппа A и гриппа B, риновируса и парагриппа 1 и 2 были взяты из ранее опубликованных методов ( Bredius et al., 2004 , Templeton et al., 2004 ), зонды TaqMan ™ для этих патогенов были адаптированы из исходных молекулярных маяков. Для коронавируса NL63 и парагриппа 3 были разработаны собственные методы ОТ-ПЦР в реальном времени с использованием Beacon Designer 2.0 (Premier Biosoft International) и Primer Express (Applied Biosystems). Консервативные целевые области были идентифицированы с помощью BLAST (www.ncbi.nlm.nih.gov/blast). Для коронавируса NL63 и парагриппа 3 были выбраны области в генах 1a и гемаглуттинина соответственно.Было показано, что праймеры и зонды обнаруживают все представленные последовательности NL63 и парагриппа 3. При использовании алгоритма mfold (www.bioinfo.rpi.edu) мешающие вторичные структуры не наблюдались.

Таблица 1

Праймеры и зонды, используемые в анализах триплексной ОТ-ПЦР в реальном времени

900GA RSACATCATAATTAGGAG (250) 900GA (1000) 900GA 900ovGirus AGAC CCGQGCTGATGCA (1000) CCGGGCTGATGCA (1000) CCGQGCTGATGCA (1000) CCGQGCTGATGCA (1000)
Триплекс Патоген Последовательности праймеров (концентрация в нМ) Последовательность зонда (концентрация в нМ) Цель
1 Грипп A AAAGCGAATTTCAGTGTGAT (1000) 6FAM-CCC TCT TCG GTG AAA GCC CT-BHQ (300) NS1 ген
T GAAGGAT
Грипп B GTCCATCAAGCTCCAGTTTT (1000) CY5-CCTCCGTCTCCACCTACT TCGTT-BHQ (300) Ген нуклеопротеина
TCGTT-BHQ (300) Нуклеопротеиновый ген
Метапневмовирус человека AACCGT GTACTAAGTGATGCACTC (500) VIC-CTTTGCCATACTCAATGAACAAAC-TAMRA (300) Ген нуклеокапсидного белка
CATTGTTTGACCGGCCCCATAA (500) AGATCAACTTCTGTCATCCAGCAA (1000) 6FAM-CACCATCCAACGGAGCACAGGAGAT-BHQ (300) Ген нуклеокапсидного белка
TTCTGCACATCATAATTAGGAG (250) CY5-TTTCCCTTCCTAACCTGGACATA-BHQ (300)
TGATATCCAGCATCTTTAAGTA (1000)
VIC-TCCTCCG GCCCCTGAATG-TAMRA (300) Пять непереведенных областей
CAAAGTAGTCGGTCCCATCC (1000)
3 ACCTAC ACCTAC ACCTAAC5 ACCTAAC5 900AAC 9000AAC CAAACGATGGCTGAAAAAGGGA-BHQ (300) Ген HN
CTTCCTGCTGGTGTGTTAAT (500)
CCTACGAT
CCTACT CCTACGT 2 CCTACT TAMRA (300) Ген HN
CGTGGCATAATCTTCTTTTT (1000)
Parainlfuenza 3- CCAGGGATGATAYTAYACCA CCAGGGATGATAYTAYA 300) HN г ene
CCGGGRCACCCAGTTGTG (1000)
4 Коронвирус 229E CAGTCAAATGGQGCTGATGCA (1000)
AAAGGGCTATAAAGAGAATAAGGTATTCT (1000)
Коронавирус OC43 CGATGAGGCTATTCCGACTGACTGACT (125) GCTATTCCGACTGACTGACT (125) GCTATTCCGACTGACTGACT (125) GCCY5
CCTTCCTGAGCCTTCAATATAGTAACC (1000)
Коронавирус NL63 ACGTACTTCTATTATGAAGCATGATATTAA (1000) VIC -GCT52 VIC -GCTGCCAACAA (1000) VIC -GCTGCCAAG 051 AGCAGATCTAATGTTATACTTAAAACTACG (1000)

3.Выбор флуофоров

Все анализы ОТ-ПЦР в реальном времени были разработаны для использования в системе ПЦР в реальном времени ABI 7500. Для мультиплексной ПЦР в реальном времени ABI рекомендует маркировать зонды красителями FAM и VIC, поскольку они отличаются друг от друга, поскольку имеют разные максимумы длины волны излучения (518 нм и 554 нм). Мы выбрали CY5 в качестве третьего красителя, так как его максимумы длины волны излучения удалены как от FAM, так и от VIC (670 нм). Перекрестных помех не наблюдалось.

4. Протокол

Респираторные контроли и образцы были извлечены с использованием мини-набора крови Qiagen на Biorobot 9604 с использованием стандартных протоколов.Амплификацию проводили в реакционном объеме 25 мкл с использованием одностадийной системы q-RT-PCR Invitrogen с надстрочным индексом III, содержащей 10 мкл экстрагированного образца. Праймеры и зонды добавляли к каждой реакции ПЦР в указанной концентрации (). Обратную транскрипцию проводили в течение 15 мин при 50 ° C. Полимераза Platinum taq была активирована при 95 ° C в течение 2 минут, и 40 циклов ПЦР выполнялись при 95 ° C в течение 8 секунд и 60 ° C в течение 34 секунд с использованием ABI 7500 SDS. Общее время реакции на триплексную реакцию составляло приблизительно 75 мин.

5. Аналитическая чувствительность

Все анализы ПЦР в реальном времени были ранее оценены в их исходных форматах с одной мишенью или дуплексом с использованием панелей известных культур и DIF или вложенных ПЦР-положительных и отрицательных образцов. Все анализы ОТ-ПЦР в реальном времени были более чувствительными, чем традиционные или вложенные методы ОТ-ПЦР (данные не показаны). Все анализы ОТ-ПЦР в реальном времени (кроме коронавируса NL63 и парагриппа 2) также оценивались с помощью респираторной панели молекулярной диагностики контроля качества (QCMD) ( Forde et al., в печати ). Каждый тест ОТ-ПЦР в реальном времени обнаруживал соответствующую мишень при соответствующем разбавлении конечной точки.

6. Чувствительность по сравнению с существующими методами диагностики

Четыре мультиплексных анализа RT-PCR в реальном времени были разработаны для одновременного обнаружения

  • 1.

    гриппа A, гриппа B и hMPV;

  • 2.

    RSV A, RSV B и риновирус;

  • 3.

    парагрипп 1, 2 и 3;

  • 4.

    коронавирус 229E, OC43 и NL63.

Каждый триплексный анализ ОТ-ПЦР в реальном времени первоначально оценивался с использованием положительных контролей и сравнивался с предыдущим дублирующим или одиночным целевым форматом. Затем триплексные анализы сравнивали с панелями тканевых культур и положительными образцами DIF и / или вложенными ОТ-ПЦР (при наличии). Чтобы определить, будут ли смешанные инфекции снижать конечную точку триплексной чувствительности, разведения каждой вирусной мишени были протестированы как для одной мишени, так и для объединенной мишени (содержащей 10 различных вирусных мишеней при одном и том же разведении конечной точки).

6.1. Мультиплексная ОТ-ПЦР в реальном времени для метапневмовируса гриппа A, гриппа B и человека

Положительные контрольные образцы на грипп A, грипп B и hMPV были протестированы в трех лунках с использованием триплексного анализа параллельно с предыдущим дуплексным или одиночным целевым форматом ( ). Между методами не было значительной потери чувствительности (о чем свидетельствует порог цикла (Ct)). Затем триплексный анализ был протестирован на 11 образцах, положительных на грипп А. Триплексный анализ обнаружил все предыдущие положительные образцы.Конечное разведение как одиночных целевых контролей, так и объединенных контролей формата было обнаружено с помощью триплексного анализа, показывающего, что «смешанные инфекции» не снизят чувствительность этого анализа.

Таблица 2

Сравнение Ct положительных контролей в трех повторах для вируса гриппа A, гриппа B и HmPv в одинарной, дуплексной и тройной реакции RT-PCR

Среднее значение Ct (± SEM)
Flu A в дуплексном режиме 29.91 (0,1)
Flu A в триплексе 30,46 (0,32)
Flu B в дуплексе 25,90 (0,21)
Flu B в триплексе 26,22 (0,53)
hMPV в одиночном 29,83 (0,38)
hMPV в триплексном 28,93 (0,18)

6.2. Мультиплексная ОТ-ПЦР в реальном времени для RSV A, RSV B и риновируса

Положительные образцы на RSV A, RSV B и риновирус были протестированы в триплексном формате в трех экземплярах и сравнивались с дуплексным или одиночным целевым форматом ( ).Для RSV A и RSV B не наблюдалось потери чувствительности. Чувствительность RT-PCR риновируса в реальном времени улучшалась при включении в триплексный анализ (как показано снижением Ct). Это повышение чувствительности было специфичным для образца (происходило только с положительным контролем), поскольку при тестировании образцов с положительным риновирусом не наблюдалось снижения Ct. Затем триплексный анализ оценивали на 42 образцах, положительных по RSV (образцы NPA, положительные с помощью DIF и гнездовой ПЦР на основе геля), и 11 образцах, положительных по риновирусу.Триплексный анализ обнаружил все ранее положительные образцы. Конечное разведение как одиночных целевых контролей для RSV A, RSV B и риновируса, так и объединенных контролей формата (содержащих 10 вирусных мишеней) было обнаружено с помощью триплексного анализа, показывающего, что «смешанные инфекции» не снизят чувствительность этого анализа.

Таблица 3

Сравнение Ct для RSV A, RSV B и риновируса в одинарных, дуплексных и триплексных реакциях RT-PCR

Среднее значение Ct (± S.ME)
RSV A дуплекс 17,43 (0,28)
RSV A триплекс 17,19 (0,15)
RSV B дуплекс 22,06 (0,22)
RSV B триплекс 21,17 (0,28)
Rhino single 26,05 (0,13)
Rhino triplex 23,85 (0,02)

6.3. Мультиплексная ОТ-ПЦР в реальном времени для парагриппа 1, 2 и 3

Положительные контрольные образцы на парагрипп 1, 2 и 3 были протестированы в формате триплекс, либо с новым анализом PF3, либо с исходным тестом.Внедрение нового анализа PF3 не повлияло на чувствительность анализов ОТ-ПЦР PF1 и PF2 ( ). Однако новая ОТ-ПЦР PF3 оказалась более чувствительной, чем предыдущий метод. Затем новый триплексный анализ сравнивали с опубликованным методом на 19 образцах, положительных по DIF PF3. Новый метод позволил выявить один дополнительный образец (19 против 18). Конечное разведение как одиночных целевых контролей, так и объединенных контролей формата было обнаружено с помощью триплексного анализа, показывающего, что «смешанные инфекции» не снизят чувствительность этого анализа.

Таблица 4

Сравнение опубликованного триплексного анализа парагриппа с триплексным анализом парагриппа, включающим новый анализ ОТ-ПЦР PF3

38
Ct контроля PF1 Ct контроля PF2 Ct контроля PF3
Опубликован триплексный анализ парагриппа 28,34 24,17 28,37
Опубликован триплексный анализ парагриппа с новым PF3 PCR 27.75 25,02 24,24

6.4. Мультиплексная ОТ-ПЦР в реальном времени на коронавирус 229E, OC43 и NL63

Положительные образцы на коронавирус 229E, OC43 и NL63 были протестированы в триплексном формате и в дуплексном или одиночном целевом формате ( ). Существенных изменений Ct не наблюдалось. Конечное разведение как одиночных целевых контролей, так и объединенных контролей формата было обнаружено с помощью триплексного анализа, показывающего, что «смешанные инфекции» не снизят чувствительность этого анализа.

Таблица 5

Сравнение Ct для одиночных, дуплексных и тройных анализов RT-PCR для конровирусов 229E, OC43 и NL63

26.23
Ct контроля OC43 Ct контроля 229E Ct NL63 контроль
Анализ OC34 / 229E / NL63 23,76 31,9 26,67
Анализ OC43 / 229E 23,63 31,3
NL63

Мы показали, что эти триплексные анализы ОТ-ПЦР в реальном времени, по крайней мере, столь же чувствительны, как и наши предыдущие анализы ОТ-ПЦР. Быстрота, стабильность и простота использования этих триплексных анализов ОТ-ПЦР в реальном времени позволяют сократить время цикла (12 патогенов в течение рабочего дня), упростить интерпретацию и повысить рентабельность. Внедрение этих тестов, несомненно, улучшит ведение пациентов, процедуры инфекционного контроля и эффективность систем эпиднадзора.

Ссылки

  • Bredius R.G., Templeton K.E., Scheltinga S.A., Claas E.C., Kroes A.C., Vossen J.M.Проспективное исследование респираторных вирусных инфекций у пациентов с трансплантацией гемопоэтических стволовых клеток у детей. Pediatr Infect Dis J. 2004; 23 (июнь (6)): 518–522. [PubMed] [Google Scholar]
  • Forde et al., Статья в печати.
  • Маккей И.М., Джейкоб К.С., Вулхаус Д., Уоллер К., Сирмис М.В., Уилли Д.М. Молекулярные анализы для обнаружения метапневмовируса человека.J Clin Microbiol. 2003; 41 (январь (1)): 100–105. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Templeton KE, Scheltinga SA, Beersma MF, Kroes AC, Claas EC Быстрый и чувствительный метод с использованием мультиплексной ПЦР в реальном времени для диагностики инфекций, вызываемых вирусами гриппа A и гриппа B, респираторно-синцитиальный вирус и вирусы парагриппа 1, 2, 3 и 4. J. Clin Microbiol. 2004; 42 (апрель (4)): 1564–1569. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • ван Элден Л.Дж., ван Лун А.М., ван Альфен Ф., Хендриксен К.А., Хёпельман А.И., ван Краай М.Г. Частое обнаружение коронавирусов человека в клинических образцах от пациентов с инфекцией дыхательных путей с помощью новой полимеразной цепной реакции с обратной транскриптазой в реальном времени. J Infect Dis. 2004; 189 (февраль (4)): 652–657. [Epub 2004, 28 января] [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • ван Элден Л.Дж., ван Лун А.М., ван дер Бик А., Хендриксен К.А., Хёпельман А.И., ван Краай М.Г. Применимость количественного анализа ПЦР в реальном времени для диагностики респираторно-синцитиальной вирусной инфекции у взрослых с ослабленным иммунитетом.J Clin Microbiol. 2003; 41 (сентябрь (9)): 4378–4381. [Бесплатная статья PMC] [PubMed] [Google Scholar]

Обнаружение 12 респираторных вирусных инфекций в режиме реального времени с помощью ОТ-ПЦР в четырех реакциях триплекс

J Clin Virol. 2005 Aug; 33 (4): 341–344.

Западно-Шотландский специализированный центр вирусологии, больница общего профиля Гартнавел, Грейт Вестерн Роуд, Глазго, G12 OYN, Великобритания

Получено 13 октября 2004 г .; Принято 29 ноября 2004 г.

Copyright © 2005 Elsevier B.V. Все права защищены.

С января 2020 года компания Elsevier создала ресурсный центр COVID-19 с бесплатной информацией на английском и китайском языках о новом коронавирусе COVID-19. Ресурсный центр COVID-19 размещен на сайте публичных новостей и информации компании Elsevier Connect. Elsevier настоящим разрешает сделать все свои исследования, связанные с COVID-19, которые доступны в ресурсном центре COVID-19, включая этот исследовательский контент, немедленно в PubMed Central и других финансируемых государством репозиториях, таких как база данных COVID ВОЗ с правами на неограниченное исследование, повторное использование и анализ в любой форме и любыми средствами с указанием первоисточника.Эти разрешения предоставляются Elsevier бесплатно до тех пор, пока ресурсный центр COVID-19 остается активным.

Эта статья цитируется в других статьях в PMC.

1. Введение

Традиционная вирусная культура, обычно в сочетании с прямой иммунофлюоресценцией (DIF), является золотым стандартом для лабораторной диагностики респираторных вирусных инфекций. Однако эти методы малочувствительны, трудоемки, имеют длительное время обработки и не могут обнаружить все известные вирусные респираторные патогены.ПЦР более чувствительна и специфична, чем традиционные методы, и может использоваться для обнаружения требовательных вирусов. ПЦР в реальном времени по крайней мере так же чувствительна, как и протоколы вложенной ПЦР на основе геля, и обеспечивает повышенную скорость (результаты доступны в течение рабочего дня). Использование специальных маркированных зондов обеспечивает легкую интерпретацию при использовании в мультиплексном формате. Мы описываем четыре метода ОТ-ПЦР на основе триплексной TaqMan ™, адаптированные из опубликованных методов и доработанные внутри компании для диагностики 12 вирусных респираторных патогенов.

2. Выбор праймеров и зондов

Праймеры и зонды для каждого триплекса описаны полностью ( ). Анализы ОТ-ПЦР в реальном времени для метапневмовируса человека (hMPV) ( Mackay et al., 2003 ), RSV A и B ( van Elden et al., 2003 ) и коронавируса 229E и OC43 ( van Elden et al. al., 2004 ) были опубликованы ранее. Хотя праймеры для обнаружения гриппа A и гриппа B, риновируса и парагриппа 1 и 2 были взяты из ранее опубликованных методов ( Bredius et al., 2004 , Templeton et al., 2004 ), зонды TaqMan ™ для этих патогенов были адаптированы из исходных молекулярных маяков. Для коронавируса NL63 и парагриппа 3 были разработаны собственные методы ОТ-ПЦР в реальном времени с использованием Beacon Designer 2.0 (Premier Biosoft International) и Primer Express (Applied Biosystems). Консервативные целевые области были идентифицированы с помощью BLAST (www.ncbi.nlm.nih.gov/blast). Для коронавируса NL63 и парагриппа 3 были выбраны области в генах 1a и гемаглуттинина соответственно.Было показано, что праймеры и зонды обнаруживают все представленные последовательности NL63 и парагриппа 3. При использовании алгоритма mfold (www.bioinfo.rpi.edu) мешающие вторичные структуры не наблюдались.

Таблица 1

Праймеры и зонды, используемые в анализах триплексной ОТ-ПЦР в реальном времени

900GA RSACATCATAATTAGGAG (250) 900GA (1000) 900GA 900ovGirus AGAC CCGQGCTGATGCA (1000) CCGGGCTGATGCA (1000) CCGQGCTGATGCA (1000) CCGQGCTGATGCA (1000)
Триплекс Патоген Последовательности праймеров (концентрация в нМ) Последовательность зонда (концентрация в нМ) Цель
1 Грипп A AAAGCGAATTTCAGTGTGAT (1000) 6FAM-CCC TCT TCG GTG AAA GCC CT-BHQ (300) NS1 ген
T GAAGGAT
Грипп B GTCCATCAAGCTCCAGTTTT (1000) CY5-CCTCCGTCTCCACCTACT TCGTT-BHQ (300) Ген нуклеопротеина
TCGTT-BHQ (300) Нуклеопротеиновый ген
Метапневмовирус человека AACCGT GTACTAAGTGATGCACTC (500) VIC-CTTTGCCATACTCAATGAACAAAC-TAMRA (300) Ген нуклеокапсидного белка
CATTGTTTGACCGGCCCCATAA (500) AGATCAACTTCTGTCATCCAGCAA (1000) 6FAM-CACCATCCAACGGAGCACAGGAGAT-BHQ (300) Ген нуклеокапсидного белка
TTCTGCACATCATAATTAGGAG (250) CY5-TTTCCCTTCCTAACCTGGACATA-BHQ (300)
TGATATCCAGCATCTTTAAGTA (1000)
VIC-TCCTCCG GCCCCTGAATG-TAMRA (300) Пять непереведенных областей
CAAAGTAGTCGGTCCCATCC (1000)
3 ACCTAC ACCTAC ACCTAAC5 ACCTAAC5 900AAC 9000AAC CAAACGATGGCTGAAAAAGGGA-BHQ (300) Ген HN
CTTCCTGCTGGTGTGTTAAT (500)
CCTACGAT
CCTACT CCTACGT 2 CCTACT TAMRA (300) Ген HN
CGTGGCATAATCTTCTTTTT (1000)
Parainlfuenza 3- CCAGGGATGATAYTAYACCA CCAGGGATGATAYTAYA 300) HN г ene
CCGGGRCACCCAGTTGTG (1000)
4 Коронвирус 229E CAGTCAAATGGQGCTGATGCA (1000)
AAAGGGCTATAAAGAGAATAAGGTATTCT (1000)
Коронавирус OC43 CGATGAGGCTATTCCGACTGACTGACT (125) GCTATTCCGACTGACTGACT (125) GCTATTCCGACTGACTGACT (125) GCCY5
CCTTCCTGAGCCTTCAATATAGTAACC (1000)
Коронавирус NL63 ACGTACTTCTATTATGAAGCATGATATTAA (1000) VIC -GCT52 VIC -GCTGCCAACAA (1000) VIC -GCTGCCAAG 051 AGCAGATCTAATGTTATACTTAAAACTACG (1000)

3.Выбор флуофоров

Все анализы ОТ-ПЦР в реальном времени были разработаны для использования в системе ПЦР в реальном времени ABI 7500. Для мультиплексной ПЦР в реальном времени ABI рекомендует маркировать зонды красителями FAM и VIC, поскольку они отличаются друг от друга, поскольку имеют разные максимумы длины волны излучения (518 нм и 554 нм). Мы выбрали CY5 в качестве третьего красителя, так как его максимумы длины волны излучения удалены как от FAM, так и от VIC (670 нм). Перекрестных помех не наблюдалось.

4. Протокол

Респираторные контроли и образцы были извлечены с использованием мини-набора крови Qiagen на Biorobot 9604 с использованием стандартных протоколов.Амплификацию проводили в реакционном объеме 25 мкл с использованием одностадийной системы q-RT-PCR Invitrogen с надстрочным индексом III, содержащей 10 мкл экстрагированного образца. Праймеры и зонды добавляли к каждой реакции ПЦР в указанной концентрации (). Обратную транскрипцию проводили в течение 15 мин при 50 ° C. Полимераза Platinum taq была активирована при 95 ° C в течение 2 минут, и 40 циклов ПЦР выполнялись при 95 ° C в течение 8 секунд и 60 ° C в течение 34 секунд с использованием ABI 7500 SDS. Общее время реакции на триплексную реакцию составляло приблизительно 75 мин.

5. Аналитическая чувствительность

Все анализы ПЦР в реальном времени были ранее оценены в их исходных форматах с одной мишенью или дуплексом с использованием панелей известных культур и DIF или вложенных ПЦР-положительных и отрицательных образцов. Все анализы ОТ-ПЦР в реальном времени были более чувствительными, чем традиционные или вложенные методы ОТ-ПЦР (данные не показаны). Все анализы ОТ-ПЦР в реальном времени (кроме коронавируса NL63 и парагриппа 2) также оценивались с помощью респираторной панели молекулярной диагностики контроля качества (QCMD) ( Forde et al., в печати ). Каждый тест ОТ-ПЦР в реальном времени обнаруживал соответствующую мишень при соответствующем разбавлении конечной точки.

6. Чувствительность по сравнению с существующими методами диагностики

Четыре мультиплексных анализа RT-PCR в реальном времени были разработаны для одновременного обнаружения

  • 1.

    гриппа A, гриппа B и hMPV;

  • 2.

    RSV A, RSV B и риновирус;

  • 3.

    парагрипп 1, 2 и 3;

  • 4.

    коронавирус 229E, OC43 и NL63.

Каждый триплексный анализ ОТ-ПЦР в реальном времени первоначально оценивался с использованием положительных контролей и сравнивался с предыдущим дублирующим или одиночным целевым форматом. Затем триплексные анализы сравнивали с панелями тканевых культур и положительными образцами DIF и / или вложенными ОТ-ПЦР (при наличии). Чтобы определить, будут ли смешанные инфекции снижать конечную точку триплексной чувствительности, разведения каждой вирусной мишени были протестированы как для одной мишени, так и для объединенной мишени (содержащей 10 различных вирусных мишеней при одном и том же разведении конечной точки).

6.1. Мультиплексная ОТ-ПЦР в реальном времени для метапневмовируса гриппа A, гриппа B и человека

Положительные контрольные образцы на грипп A, грипп B и hMPV были протестированы в трех лунках с использованием триплексного анализа параллельно с предыдущим дуплексным или одиночным целевым форматом ( ). Между методами не было значительной потери чувствительности (о чем свидетельствует порог цикла (Ct)). Затем триплексный анализ был протестирован на 11 образцах, положительных на грипп А. Триплексный анализ обнаружил все предыдущие положительные образцы.Конечное разведение как одиночных целевых контролей, так и объединенных контролей формата было обнаружено с помощью триплексного анализа, показывающего, что «смешанные инфекции» не снизят чувствительность этого анализа.

Таблица 2

Сравнение Ct положительных контролей в трех повторах для вируса гриппа A, гриппа B и HmPv в одинарной, дуплексной и тройной реакции RT-PCR

Среднее значение Ct (± SEM)
Flu A в дуплексном режиме 29.91 (0,1)
Flu A в триплексе 30,46 (0,32)
Flu B в дуплексе 25,90 (0,21)
Flu B в триплексе 26,22 (0,53)
hMPV в одиночном 29,83 (0,38)
hMPV в триплексном 28,93 (0,18)

6.2. Мультиплексная ОТ-ПЦР в реальном времени для RSV A, RSV B и риновируса

Положительные образцы на RSV A, RSV B и риновирус были протестированы в триплексном формате в трех экземплярах и сравнивались с дуплексным или одиночным целевым форматом ( ).Для RSV A и RSV B не наблюдалось потери чувствительности. Чувствительность RT-PCR риновируса в реальном времени улучшалась при включении в триплексный анализ (как показано снижением Ct). Это повышение чувствительности было специфичным для образца (происходило только с положительным контролем), поскольку при тестировании образцов с положительным риновирусом не наблюдалось снижения Ct. Затем триплексный анализ оценивали на 42 образцах, положительных по RSV (образцы NPA, положительные с помощью DIF и гнездовой ПЦР на основе геля), и 11 образцах, положительных по риновирусу.Триплексный анализ обнаружил все ранее положительные образцы. Конечное разведение как одиночных целевых контролей для RSV A, RSV B и риновируса, так и объединенных контролей формата (содержащих 10 вирусных мишеней) было обнаружено с помощью триплексного анализа, показывающего, что «смешанные инфекции» не снизят чувствительность этого анализа.

Таблица 3

Сравнение Ct для RSV A, RSV B и риновируса в одинарных, дуплексных и триплексных реакциях RT-PCR

Среднее значение Ct (± S.ME)
RSV A дуплекс 17,43 (0,28)
RSV A триплекс 17,19 (0,15)
RSV B дуплекс 22,06 (0,22)
RSV B триплекс 21,17 (0,28)
Rhino single 26,05 (0,13)
Rhino triplex 23,85 (0,02)

6.3. Мультиплексная ОТ-ПЦР в реальном времени для парагриппа 1, 2 и 3

Положительные контрольные образцы на парагрипп 1, 2 и 3 были протестированы в формате триплекс, либо с новым анализом PF3, либо с исходным тестом.Внедрение нового анализа PF3 не повлияло на чувствительность анализов ОТ-ПЦР PF1 и PF2 ( ). Однако новая ОТ-ПЦР PF3 оказалась более чувствительной, чем предыдущий метод. Затем новый триплексный анализ сравнивали с опубликованным методом на 19 образцах, положительных по DIF PF3. Новый метод позволил выявить один дополнительный образец (19 против 18). Конечное разведение как одиночных целевых контролей, так и объединенных контролей формата было обнаружено с помощью триплексного анализа, показывающего, что «смешанные инфекции» не снизят чувствительность этого анализа.

Таблица 4

Сравнение опубликованного триплексного анализа парагриппа с триплексным анализом парагриппа, включающим новый анализ ОТ-ПЦР PF3

38
Ct контроля PF1 Ct контроля PF2 Ct контроля PF3
Опубликован триплексный анализ парагриппа 28,34 24,17 28,37
Опубликован триплексный анализ парагриппа с новым PF3 PCR 27.75 25,02 24,24

6.4. Мультиплексная ОТ-ПЦР в реальном времени на коронавирус 229E, OC43 и NL63

Положительные образцы на коронавирус 229E, OC43 и NL63 были протестированы в триплексном формате и в дуплексном или одиночном целевом формате ( ). Существенных изменений Ct не наблюдалось. Конечное разведение как одиночных целевых контролей, так и объединенных контролей формата было обнаружено с помощью триплексного анализа, показывающего, что «смешанные инфекции» не снизят чувствительность этого анализа.

Таблица 5

Сравнение Ct для одиночных, дуплексных и тройных анализов RT-PCR для конровирусов 229E, OC43 и NL63

26.23
Ct контроля OC43 Ct контроля 229E Ct NL63 контроль
Анализ OC34 / 229E / NL63 23,76 31,9 26,67
Анализ OC43 / 229E 23,63 31,3
NL63

Мы показали, что эти триплексные анализы ОТ-ПЦР в реальном времени, по крайней мере, столь же чувствительны, как и наши предыдущие анализы ОТ-ПЦР. Быстрота, стабильность и простота использования этих триплексных анализов ОТ-ПЦР в реальном времени позволяют сократить время цикла (12 патогенов в течение рабочего дня), упростить интерпретацию и повысить рентабельность. Внедрение этих тестов, несомненно, улучшит ведение пациентов, процедуры инфекционного контроля и эффективность систем эпиднадзора.

Ссылки

  • Bredius R.G., Templeton K.E., Scheltinga S.A., Claas E.C., Kroes A.C., Vossen J.M.Проспективное исследование респираторных вирусных инфекций у пациентов с трансплантацией гемопоэтических стволовых клеток у детей. Pediatr Infect Dis J. 2004; 23 (июнь (6)): 518–522. [PubMed] [Google Scholar]
  • Forde et al., Статья в печати.
  • Маккей И.М., Джейкоб К.С., Вулхаус Д., Уоллер К., Сирмис М.В., Уилли Д.М. Молекулярные анализы для обнаружения метапневмовируса человека.J Clin Microbiol. 2003; 41 (январь (1)): 100–105. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Templeton KE, Scheltinga SA, Beersma MF, Kroes AC, Claas EC Быстрый и чувствительный метод с использованием мультиплексной ПЦР в реальном времени для диагностики инфекций, вызываемых вирусами гриппа A и гриппа B, респираторно-синцитиальный вирус и вирусы парагриппа 1, 2, 3 и 4. J. Clin Microbiol. 2004; 42 (апрель (4)): 1564–1569. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • ван Элден Л.Дж., ван Лун А.М., ван Альфен Ф., Хендриксен К.А., Хёпельман А.И., ван Краай М.Г. Частое обнаружение коронавирусов человека в клинических образцах от пациентов с инфекцией дыхательных путей с помощью новой полимеразной цепной реакции с обратной транскриптазой в реальном времени. J Infect Dis. 2004; 189 (февраль (4)): 652–657. [Epub 2004, 28 января] [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • ван Элден Л.Дж., ван Лун А.М., ван дер Бик А., Хендриксен К.А., Хёпельман А.И., ван Краай М.Г. Применимость количественного анализа ПЦР в реальном времени для диагностики респираторно-синцитиальной вирусной инфекции у взрослых с ослабленным иммунитетом.J Clin Microbiol. 2003; 41 (сентябрь (9)): 4378–4381. [Бесплатная статья PMC] [PubMed] [Google Scholar]

ТЕСТ ДНК ПЦР на 12 ИНФЕКЦИЙ | ПУЛЬС-КЛИНИКА

КАКУЮ ЧАСТЬ ТЕЛА Я МОГУ ПРОВЕРИТЬ НА АСИМПТОМАТИЧЕСКИЕ ИНФЕКЦИИ С ПОМОЩЬЮ ПЦР ДНК?
Давайте подумаем о том, как мы используем свою часть тела, чтобы доставить себе (и нашим партнерам) удовольствие.

МАСТЕР ИЗ ГОРЛА

Представьте, что мы целуемся и сосем, и при любом оральном сексе, которым мы пользуемся ртом (языком и горлом), инфекции могут быть локализованы на ваших миндалинах.
Итак, для этой области мы проводим мазок, осторожно протирая тампоном (или небольшой ватной палочкой) заднюю часть горла, миндалины и любые другие области, где может быть покраснение, воспаление или гной. Мазок из горла может обнаружить 12 инфекций, упомянутых выше. Нет никаких рисков или осложнений, связанных с посевом мазка из зева. Тест может вызвать кратковременную пощечину, поскольку задняя стенка глотки является чувствительной областью, но это не должно быть болезненным.

АНАЛЬНЫЙ мазок

Неважно, мужчина вы, девушка или транс-женщина, нравится ли вам это со спины или с помощью бэкдора для развлечения заражения от ваших партнеров (или игрушек, рук , или перчатки при фистинге) могут локализоваться на поверхности анального канала или поверхности ткани прямой кишки. Не стесняйтесь обсуждать с врачом свой анальный секс и методы безопасного анального секса (мы видели много дыр раньше, и вы не будете последним). Для сбора образца в анальный канал и прямую кишку вводится небольшой ватный тампон (если хотите, большего размера). Тампон осторожно вращают, удаляют и помещают в контейнер для отправки в нашу лабораторию. Когда тампон вводится в прямую кишку, может возникнуть давление. Тест не должен причинять вам боли, мы всегда осторожны и бережно относимся к нему.

ВАГИНАЛЬНЫЙ МАСТЕР

Мы говорим о женщине и транс-женщине, вагинальный канал может быть домом для проведения вечеринки по поводу ИППП, и на самом деле ИППП среди транс-женщин не отличаются от населения без ТГ, если нет других рисков задействованные факторы. Для сбора образца во влагалище вводится небольшой ватный тампон. Тампон осторожно вращают, удаляют и помещают в контейнер для отправки в нашу лабораторию.

ПЦР МОЧИ НА 12 ИНФЕКЦИЙ

Анализ мочи на ИППП становится все более доступным.В наши дни с помощью анализа мочи можно выявить 12 ИППП. ПЦР-анализ мочи намного приятнее, чем мазки из уретры или шейки матки (старый метод, который был болезненным и неудобным), и быстро становится стандартной практикой. Анализ мочи, в отличие от мазка, облегчает людям тестирование на ИППП в рамках их регулярного медицинского обслуживания. Чтобы собрать образец для тестирования, ВЫ ПРОСТО ДОЛЖНЫ СМОТРЕТЬ !

Вот шаги, начиная с
Регистрация >> Получите наклейку с этикеткой и контейнер >> сходите в туалет
>> не вытирайте и не чистите свой пенис / влагалище >> открывайте чашу для мочи >> мочитесь первой струей мочи, пока она не станет заполнено наполовину
>> поместите чашку для мочи в пакет для образцов >> вымойте руки с помощью средства для мытья рук THANN и воды
>> передайте ее персоналу у стойки регистрации >> оплатите >> подтвердите адрес электронной почты >> Sashay away

SIMPLE ОБЩАЯ ИНФОРМАЦИЯ

Если вы хотите найти любую возможную инфекцию в уретре и мочевыводящих путях, вы должны выбрать инфекции МОЧИ ПЦР 12, которые вам нужно будет передать с мочой.

Если вы занимались оральным сексом и хотите проверить наличие инфекции в горле, вам следует выбрать инфекцию ПЦР-мазок из горла 12, в которой будет помогать наш персонал.

Если вы женщина, которая наслаждается анальным сексом без презерватива, мужчина, занимающийся сексом с мужчинами, и нижняя часть для анального секса без презерватива, тогда вам нужно выбрать инфекции ANAL SWAB PCR 12, которым будет помогать наш персонал.

Если вы женщина, которая занимается вагинальным сексом, вам следует выбрать инфекции Vaginal Swab PCR 12, которые будут сопровождаться нашими сотрудниками.

СКОЛЬКО Я ДОЛЖЕН ЖДАТЬ РЕЗУЛЬТАТОВ ПЦР МОЧИ И ПЦР мазков?

Для нормальной ПЦР на 12 инфекций процесс тестирования ПЦР занимает 7 дней.
Результаты будут отправлены на ваш адрес электронной почты, указанный в наших клиниках.

Для нормальной ПЦР на 2 инфекции (гонорея и хламидиоз) процесс ПЦР-теста занимает 3 дня.
Результаты будут отправлены на ваш адрес электронной почты, указанный в наших клиниках.

Для ПЦР PULSExpress для 2 инфекций (гонореи и хламидиоза) ПЦР-тест занимает 3 часа.
Результаты будут отправлены на ваш адрес электронной почты, указанный в наших клиниках.

ЗАБРОНИРУЙТЕ НАЗНАЧЕНИЕ СЕЙЧАС ИЛИ ПРОХОДИТЕ В БЛИЖАЙШУЮ КЛИНИКУ PULSE.

Стандартный тест на коронавирус, если он доступен, работает хорошо, но могут ли новые методы диагностики помочь в этой пандемии? | Наука

Врач в Германии готовит мазок для анализа на коронавирусную инфекцию.

Дэниел Рейнхардт / фото альянс через Getty Images

Автор Роберт Ф. Сервис

По мере того, как Соединенные Штаты стремятся активизировать тестирование на пандемический коронавирус с использованием технологии, основанной на проверенной и проверенной полимеразной цепной реакции (ПЦР), начинают внедряться альтернативные подходы, которые могут упростить и ускорить процесс определения людьми они были инфицированы.Некоторые методы модифицируют стандартный тест ПЦР, который усиливает крошечные кусочки генетического материала для обнаружения, тогда как другие секвенируют вирус напрямую или используют редактор генома CRISPR.

Грядут более быстрые и дешевые тесты, — говорит Эван Джонс, генеральный директор OpGen, компании по быстрой диагностике. Однако, добавляет он, разработка новых видов тестов «займет время». Некоторые из новых тестов уже поступают в онлайн, но для проверки других, вероятно, потребуются месяцы, и они будут готовы к широкому распространению.

«Тестирование, тестирование, тестирование» — это мантра, которую снова и снова повторяет Генеральный директор Всемирной организации здравоохранения Тедрос Адханом Гебрейесус. Диагностические тесты, выявляющие активные инфекции у людей, жизненно важны для усилий общественного здравоохранения, а не только для здоровья людей. Широко распространенное диагностическое тестирование, наряду с изоляцией инфицированных, отслеживанием контактов и помещением в карантин этих контактов, похоже, сыграло ключевую роль в работе Южной Кореи по подавлению распространения вируса.

Связанные

В Соединенных Штатах медленное развертывание ПЦР-тестов на коронавирус широко объясняется сочетанием строгих правил, направленных на обеспечение их надежности, и сложной сетью компаний и систем здравоохранения, ответственных за разработку, проведение и оплату тестов. Администрация Трампа заявляет, что тестирование ускоряется. 16 марта на пресс-конференции в Белом доме У.Помощник секретаря по вопросам здравоохранения Бретт Гироар (S. Health and Human Services) сказал, что страна сможет обработать 1 миллион тестов к концу недели и 2 миллиона на следующей неделе. Но реальные цифры еще не близки к этому. Согласно данным, собранным в рамках проекта отслеживания COVID, некоммерческого сотрудничества представителей общественного здравоохранения и журналистов, подсчитывающих тесты, проведенные в Соединенных Штатах, по состоянию на 22 марта была проведена 191 541 ПЦР-диагностика, из которых 24 345 из них оказались положительными на вирус.

29 февраля Управление по санитарному надзору за качеством пищевых продуктов и медикаментов США (FDA) опубликовало новые правила, разрешающие экстренное использование тестов на коронавирус помимо тех, которые производятся и распространяются Центрами США по контролю и профилактике заболеваний. Академические вирусологические лаборатории, департаменты здравоохранения и компании начали создавать свои собственные тесты ПЦР. Сегодня около четырех десятков организаций получили одобрение FDA на свои тесты. Среди крупнейших — диагностические компании, такие как Roche Molecular Systems, получившая на этой неделе зеленый свет на проведение испытаний FDA.По словам Александра Валсамакис, главного медицинского директора компании, на начальном этапе она будет предоставлять около 400 000 тестов в неделю в США и 3 миллиона во всем мире. Другие крупные компании также недавно получили одобрение на свои тесты, в том числе Thermo Fisher Scientific и Abbott Laboratories.

университетских вирусологических лабораториях тоже вскочили, чтобы помочь диагностировать случаи поблизости от них. Например, на прошлой неделе врачи Медицинского центра Университета Питтсбурга (UPMC) начали использовать самодельный ПЦР-тест для проверки на наличие инфекции в округе Аллегейни.На данный момент количество тестов остается небольшим, около 100 в неделю. «Нам определенно хотелось, чтобы мы начали это раньше, — говорит Алан Уэллс, возглавляющий клинические лаборатории UPMC.

ПЦР — это наиболее часто используемый тест для диагностики коронавируса, поскольку он очень точен. (См. Как работает самый распространенный тест на коронавирус?) Но его ограничивают другие проблемы. «Нам не удалось добиться необходимого улучшения», — говорит Стивен Волински, врач-инфекционист Северо-Западного университета. Каждый тест занимает около 4 часов после того, как образец поступает в централизованную лабораторию тестирования, с разделением времени между подготовкой образца и фактическим тестом ПЦР.С транспортом и очередями получение результата может занять от 2 до 4 дней. За это время инфицированные люди могут передать вирус многим другим.

Самостоятельная тампона

В диагностический ландшафт коронавируса добавляется еще одно новое измерение: «домашние» тесты, которые включают отправку образца, взятого дома, в лабораторию. Например, завтра Everlywell планирует начать поставки комплектов на дом и в розничные аптеки. Эти тесты начнутся со скрининговых вопросов в Интернете или в магазине, чтобы определить, вероятно ли, что человек подвергся воздействию вируса.Если да, они могут получить набор для отбора проб из носоглотки по почте или купить его у местного продавца. Человеку будут даны подробные инструкции по введению его собственного тампона, помещению его в защитный флакон и в ночное время по почте в одну из десятков диагностических лабораторий (которые сотрудничают с Everlywell и уже имеют одобрение FDA) для анализа ПЦР.

Франк Онг, главный медицинский и научный директор Everlywell, говорит, что компания рассчитывает быстро вырасти с тысячи таких тестов в день до десятков тысяч.Хотя каждый тест, вероятно, потребует 4-дневного ожидания результатов, говорит Онг, эта стратегия домашнего отбора проб имеет серьезные преимущества: она защитит медицинских работников от воздействия потенциальной инфекции и высвободит их время. «Нам нужно убедиться, что мы даем им возможность позаботиться о пациентах», — говорит Онг. Другие компании, в том числе Nurx и Carbon Health, заявляют, что теперь они поставляют ограниченные запасы собственных наборов для взятия проб в домашних условиях.

Большинство тестов ПЦР на новый вирус проводится на больших дорогих автоматизированных машинах, которые выполняют множество тестов одновременно.Они есть в крупных больницах или диагностических учреждениях, но сейчас начинает разворачиваться еще один вариант — это небольшие и менее дорогие устройства, которые также выполняют амплификацию нуклеиновых кислот. Они могут использоваться небольшими больницами и даже отдельными врачебными кабинетами.

В пятницу, например, компания Cepheid, которая продает небольшие системы ПЦР для быстрого обнаружения вирусов гриппа, бактерий туберкулеза и других микробов, получила одобрение FDA на экстренное использование тест-картриджа на коронавирус 2 (SARS-CoV-2), который предназначен для экстренного использования. в систему GenXpert компании, устройство размером с кофемашину, которое может выдать диагностический результат всего за 45 минут.Официальные лица Cepheid говорят, что во всем мире установлено 23 000 таких систем, из них 5000 — в США. 19 марта GenMark получил одобрение FDA на экстренное использование собственных тестов на коронавирус, которые проводятся на машинах аналогичного размера, которые используют запатентованный электрохимический подход для обнаружения целевого генетического материала менее чем за 2 часа. Другие компании, спешащие поставить диагностические аппараты для пунктов оказания медицинской помощи, включают Mesa Biotech, HiberGene, Mobidiag и QuantuMDx.

То же самое и с такими компаниями, как Oxford Nanopore и Fulgent Genetics, которые вместо использования ПЦР напрямую секвенируют любой генетический материал в образце, а затем ищут совпадения, скажем, с новым коронавирусом.Этот подход к высокоскоростному секвенированию генов может помочь охарактеризовать геном коронавируса, чтобы лучше понять, как вирус развивается, но он также может быть диагностическим в определенных ситуациях, таких как удаленные сайты без доступа к ПЦР. Портативные устройства Oxford Nanopore использовались во время вспышек лихорадки Эбола, и компания отправила их в Китай на ранних этапах пандемии.

CRISPR для тестирования

Самый быстрый способ тестирования на коронавирус в конечном итоге может быть предложен компаниями, использующими редактор генома CRISPR, более известный тем, что он добавляет или удаляет ДНК в клетках.Две американские компании, Mammoth Biosciences и Sherlock Biosciences, заявляют, что они создали тесты на основе CRISPR и в настоящее время проверяют их на образцах пациентов, прежде чем обращаться за разрешением на экстренное использование в FDA. Метод начинается с образца пациента, извлекается вирусная РНК и используется тест быстрой амплификации нуклеиновых кислот, называемый петлевой амплификацией, чтобы получить ровно столько РНК, чтобы тест мог ее обнаружить. Затем исследователи добавляют два компонента редактора генома CRISPR: белок под названием CAS12, который разрезает ДНК или РНК, и «направляющую» РНК, которая вставляется в CAS12 и помогает ему найти последовательность, соответствующую части генома коронавируса.Если CAS12 и его руководство находят совпадение в РНК, CAS12 связывается с этой совпадающей РНК, которая активирует CAS12, чтобы разрезать ее и продолжить разрезать любые другие короткие цепи РНК или ДНК поблизости, включая копии цепи, предназначенные для высвобождения цвета. — изменение молекул, когда CAS12 отсекает их. Результатом может быть простое изменение цвета тест-полоски.

Этот метод отлично подходит для поиска небольших фрагментов генетического материала, говорит Дженнифер Дудна, биохимик из Калифорнийского университета (UC), пионер CRISPR, председатель научного консультативного совета Mammoth Biosciences.

В препринте, опубликованном 10 марта на medRxiv, исследователи из Mammoth Biosciences и Калифорнийского университета в Сан-Франциско сообщают, что тесты на клинических образцах дали результаты с точностью, сравнимой с ПЦР, всего за 30 минут. Он использует простую полосу, похожую на бумагу, с цветной линией, которая появляется с положительным результатом. По словам Тревора Мартина, генерального директора Mammoth, компания обсуждает с партнерами производство наборов для тестирования, которые позволят быстро и дешево диагностировать инфекцию SARS-CoV-2 в домашних условиях, не требуя медицинских знаний.

На завершение теста и получение одобрения регулирующих органов могут уйти месяцы, поэтому, скорее всего, он не будет готов в ближайшие решающие недели. Но он может быть готов, если распространение коронавируса продолжится. Некоторые предсказывают, что вирус тоже исчезнет, ​​но осенью снова появятся инфекции. Мартин говорит, что для получения результатов не потребуются машины для ПЦР, управляемые обученными специалистами. «Это изменит правила игры в нашей реакции» на возникающие болезни, — говорит Мартин.

Проблемы со снабжением

Несмотря на то, что компании и академические лаборатории расширяют свои усилия по диагностике на основе ПЦР, больницы и центры тестирования по всей стране сообщают, что они столкнулись с более серьезным кризисом: у многих заканчиваются химические вещества и другие материалы, которые позволяют проводить тесты, такие как тампоны для сбора образцов у пациентов и реагенты, необходимые для ПЦР.Бенджамин Пински, патолог Стэнфордского университета, который разработал диагностический тест на основе ПЦР, используемый в Северной Калифорнии, говорит, что его лаборатория сталкивается с постоянной нехваткой различных материалов, особенно наборов, используемых для извлечения РНК из вирусных образцов, прежде чем ее можно будет загрузить в ПЦР-машины.

«Это был большой вызов», — говорит Пинский. «Мы должны были быть очень ловкими, чтобы справиться с этим», постоянно меняя поставщиков или даже химические процедуры, которые необходимо проверять, прежде чем их можно будет использовать на образцах пациентов.Его команда даже разослала в Твиттере просьбы к сообществу Стэнфорда и региональным биотехнологическим компаниям с просьбой пожертвовать наборы реагентов, такие как наборы от Zymo и Qiagen. По словам Пинского, несмотря на то, что поступают пожертвования, запасов по-прежнему не хватает.

Реагентные компании пытаются ответить. Например, Qiagen, крупный поставщик наборов для экстракции РНК, объявил во вторник, что его сотрудники работают круглосуточно, чтобы увеличить производство с 1,5 миллиона наборов в месяц до 6.5 миллионов в месяц до конца апреля, а позже увеличится.

Пинский, например, говорит, что он готов к тому, чтобы компании полностью взяли на себя тестирование на коронавирус у таких ученых, как он сам. «Я надеюсь, что эти компании смогут провести обещанные испытания», — говорит Пинский. «Это еще предстоит выяснить.»

Одно число может помочь понять, насколько заразен пациент с COVID-19. Должны ли результаты тестирования включать это? | Наука

Положительные тесты на коронавирус также могут выявить заразность человека.

МАРТИН БЕРНЕТТИ / AFP через Getty Images

Автор Роберт Ф. Сервис

Отчеты Science о ​​COVID-19 поддерживаются Пулитцеровским центром и Фондом Хейзинг-Саймонса.

С самого начала пандемии коронавируса бушевали битвы из-за тестирования: какие тесты следует сдавать, кому и как часто? Теперь эпидемиологи и эксперты в области общественного здравоохранения открывают новую дискуссию.Они говорят, что центры тестирования должны сообщать не только о том, является ли человек положительным, но и о числе, известном как значение порога цикла (CT), которое указывает, сколько вируса переносит инфицированный человек.

Защитники

указывают на новое исследование, показывающее, что значения КТ могут помочь врачам выявлять пациентов с высоким риском серьезного заболевания. Недавние результаты также показывают, что эти цифры могут помочь чиновникам определить, кто заразен, и поэтому их следует изолировать и выследить их контакты. Защитники признают, что величина CT — это несовершенная мера.Но добавлять ли его к результатам тестов «- это один из самых актуальных вопросов», — говорит Майкл Мина, врач и эпидемиолог из T.H. Гарвардского университета. Школа общественного здравоохранения Чан

Связанные

Стандартные тесты выявляют инфекции SARS-CoV-2 путем выделения и амплификации вирусной РНК с использованием процедуры, известной как полимеразная цепная реакция (ПЦР), которая основана на нескольких циклах амплификации для получения детектируемого количества РНК. Значение CT — это количество циклов, необходимых для обнаружения вируса; В этот момент машины ПЦР перестают работать.Если после 37-40 циклов не наблюдается положительного сигнала, тест отрицательный. Но образцы, которые оказываются положительными, могут начинаться с совершенно разных количеств вируса, для которых значение CT дает обратную меру. Тест, который регистрирует положительный результат после 12 раундов при значении CT, равном 12, начинается с более чем в 10 миллионов раз большего количества вирусного генетического материала, чем образец со значением CT 35.

Но один и тот же образец может давать разные значения КТ на разных испытательных машинах, и разные мазки от одного и того же человека могут давать разные результаты.«Значение КТ не является абсолютной шкалой, — говорит Марта Гаглия, вирусолог из Университета Тафтса. По словам Мины, это настораживает многих врачей. «Клиницисты по своей природе осторожны, — говорит Мина. «Они говорят:« Если мы не можем на это положиться, это ненадежно »». В августовском письме в Clinical Infectious Diseases члены Коллегии американских патологов призвали к осторожности при интерпретации значений компьютерной томографии.

Тем не менее, Мина, Гаглия и другие утверждают, что знание того, являются ли значения КТ высокими или низкими, может быть очень информативным.«Даже при всех недостатках знание вирусной нагрузки может быть очень сильным», — говорит Мина.

Ранние исследования показали, что пациенты в первые дни заражения имеют значения CT ниже 30, а часто и ниже 20, что указывает на высокий уровень вируса; по мере того, как организм очищается от коронавируса, значения КТ постепенно повышаются. Более поздние исследования показали, что более высокая вирусная нагрузка может серьезно повлиять на заразность человека и отражать тяжесть заболевания.

В исследовании, опубликованном на этой неделе в журнале Clinic Infectious Diseases , исследователи под руководством Бернара Ла Сколы, эксперта по инфекционным заболеваниям из IHU-Méditerranée Infection, изучили 3790 положительных образцов с известными значениями КТ, чтобы определить, содержат ли они жизнеспособный вирус, что указывает на пациентов. были скорее всего заразными.Ла Скола и его коллеги обнаружили, что 70% образцов со значениями CT 25 или ниже можно культивировать, по сравнению с менее чем 3% случаев со значениями CT выше 35. «Справедливо сказать, что наличие более высокой вирусной нагрузки связано с быть более заразным », — говорит Моника Ганди, специалист по инфекционным заболеваниям Калифорнийского университета в Сан-Франциско.

И наоборот, люди часто дают положительный результат в течение недель или даже месяцев после выздоровления, но имеют высокие значения КТ, что позволяет предположить, что ПЦР выявила генетический материал из неинфекционных вирусных остатков.Текущие руководящие принципы Центров по контролю и профилактике заболеваний и Всемирной организации здравоохранения, которые призывают пациентов изолировать себя в течение 10 дней после появления симптомов, признают, что они вряд ли заразятся после этого периода. Но Мина и другие говорят, что недавние результаты также предполагают, что пациент, который прошел несколько тестов с высокими значениями КТ, вероятно, находится в конце инфекции и не нуждается в изоляции. Он добавляет, что трассеры контактов должны упорядочивать свои усилия на основе значений КТ.«Если 100 файлов попадут на мой стол [в качестве средства отслеживания контактов], я сначала расставлю по приоритетам самые высокие вирусные нагрузки, потому что они наиболее заразны», — говорит Мина.

Широкий доступ к значениям КТ также может помочь эпидемиологам отслеживать вспышки, говорит Мина. Если исследователи увидят много низких значений КТ, они могут сделать вывод, что вспышка распространяется. Но если почти все значения КТ высокие, вспышка, скорее всего, идет на убыль. «Мы должны перестать думать о людях как о положительном или отрицательном и спросить, насколько положительно?» — говорит Мина.

Значения

CT также могут помочь клиницистам выявить пациентов, наиболее подверженных риску тяжелого заболевания и смерти. В июньском отчете исследователей Weill Cornell Medicine было обнаружено, что среди 678 госпитализированных пациентов 35% пациентов со значением CT 25 или менее умерли, по сравнению с 17,6% с значением CT от 25 до 30 и 6,2% с значением CT. выше 30. В августе исследователи из Бразилии обнаружили, что среди 875 пациентов те, у кого значение CT 25 или ниже, с большей вероятностью заболеют тяжелым заболеванием или умрут.

Ганди согласен с тем, что доступ к значениям компьютерной томографии может помочь врачам выявлять людей с высоким риском развития симптомов.Тем не менее, она и другие отмечают, что высокая вирусная нагрузка не обязательно ведет к заболеванию; около 40% людей, заболевших SARS-CoV-2, остаются здоровыми, даже если у них такое же количество вируса, как и у больных. «Как врач, компьютерная томография — не единственное, что я буду использовать» для диагностики и отслеживания пациентов, — говорит Чану Ри, эпидемиолог больницы Brigham and Women’s Hospital. «Но я все еще нахожу это полезным».

.

Добавить комментарий

Ваш адрес email не будет опубликован.