Александр васильевич резайкин: Резайкин Александр Васильевич | Лечебный Центр

Содержание

Медицинская помощь в ЛЦ-А

Адрес места нахождения и телефон вышестоящего лицензирующего органа:

 

Департамент здравоохранения города Москвы

127006, г. Москва, Оружейный пер., д.43

руководитель: Хрипун Алексей Иванович

www.mosgorzdrav.ru

 

понедельник - четверг: с 9.00 до 18.00,
перерыв на обед с 13.30 до 14.30

 

пятница: с 9.00 до 16.45,
перерыв на обед с 13.30 до 14.30

 

Информацию о регистрации письменных обращений, поступивших в Департамент здравоохранения города Москвы, можно получить ежедневно с понедельника

по четверг с 08.00 до 17.00 и в пятницу

с 08.00 до 15.45,

обед - с 12.30 до 13.30, по телефонам:
+7 (499) 251-31-39, +7 (499) 251-33-04

 

Единая справочная служба города Москвы (в том числе по вопросам доступности и качества бесплатной медицинской помощи) 8 (495) 777-77-77

 

 

 

 

Адрес и телефон органа управления здравоохранением, территориальных

органов Росздравнадзора и Роспотребнадзора:

 

Территориальный орган Росздравнадзора
по г. Москве и Московской области:

127206, г. Москва, ул. Вучетича, д.12 А

Режим работы: пн – чт: 9.00 – 17.45,
пт: 9.00 – 16.30, перерыв на обед: 13.00 - 13.30

сб – вс: выходные дни.

Горячая линия ТО Росздравнадзора:
8 (495) 611-47-74; 8 (916) 256-76-76

 

Управление Федеральной службы по надзору
в сфере защиты прав потребителей
и благополучия человека по городу Москве

129626, г. Москва, Графский переулок,
д. 4, корп. 2, 3, 4

 

сайт: 77.rospotrebnadzor.ru

 

Телефон: 7 (495) 687-40-35

Время приема обращения граждан: понедельник-четверг: c 9:00 до 17:30,

пятница c 9:00 до 16:30, обед с 13:00 до 13:45

 

Информацию о регистрации письменных
и электронных обращений и запросов

организаций и граждан, поступивших
в Управление Федеральной службы
по надзору в сфере защиты прав потребителей и благополучия человека по городу Москве, можно получить ежедневно с 9:00 до 18:00
по телефону 7 (495) 687-36-08

Муниципальное автономное образовательное учреждение дополнительного образования "Детско-юношеский центр г. Навашино"

Об образовательной организации
Полное наименование организации: Муниципальное автономное образовательное учреждение дополнительного образования "Детско-юношеский центр г.Навашино"
Краткое наименование организации: МАОУ ДО "ДЮЦ г.Навашино"
Руководитель: Резайкин Александр Васильевич
Тип образовательной организации: организация дополнительного образования
Вид образовательной организации: автономное
Дата создания организации: 01.09.1978

Учредители образовательной организации
Администрация городского округа Навашинский
Руководитель: Глава Администрации – Берсенева Татьяна Александровна
Адрес: 607102, Нижегородская область, городской округ Навашинский, г. Навашино, площадь Ленина, д.7
Телефоны: (83175) 5- 77-49 Факс: (83175) 5-60-56
Сайт: http://navashino.omsu-nnov.ru
E-Mail: о[email protected]

Место нахождения образовательной организации
Адрес: 607102, Российская Федерация, Приволжский федеральный округ, Нижегородская обл., Навашинский р-н, Навашино г., 1 Мая ул., д.6

Режим и график работы
Режим работы: Режим работы образовательной организации по расписанию занятий на текущий учебный год (Файл (PDF; 264Кб))
График работы: Пятидневная рабочая неделя у административных работников, учебно- вспомогательного и обслуживающего персонала с понедельника по пятницу с 08.00-17.00 (обеденный перерыв: 12.00-13.00), выходные дни, суббота, воскресенья. А у педагогических работников согласно расписанию учебно- тренировочного процесса.

Контакты
Описание организации

МАОУ ДО "ДЮЦ г.Навашино" организует дополнительное образование детей и подростков по четырем видам спорта:

- Футбол

- Флорбол

- Лыжные гонки

- Плавание

Все персональные данные размещены с согласия субъекта(ов) на обработку персональных данных
Контент является обязательным к размещению
Информация, содержащаяся в разделе «Сведения об образовательной организации», однозначно идентифицируются как обязательный к размещению контент

МАОУ ДО "ДЮЦ Г.НАВАШИНО", ИНН 5223003798

Основание внесения оператора в реестр (номер приказа): 434

Наименование оператора: Муниципальное автономное образовательное учреждение дополнительного образования «Детско-юношеская спортивная школа г. Навашино»

Адрес местонахождения оператора: 607100, Нижегородская обл., Навашинский р-н, г. Навашино, ул. 1 Мая, д. 6

Дата начала обработки персональных данных: 15.05.2015

Субъекты РФ, на территории которых происходит обработка персональных данных: Нижегородская область

Цель обработки персональных данных: Ведение кадровой документации по сотрудникам оператора, учет сведений об обучающихся и их родителей (законных представителей), осуществление уставных видов деятельности.

Описание мер, предусмотренных ст. 18.1 и 19 Закона: Оператором назначен ответственный за организацию обработки персональных данных, оператором приняты документы, определяющие политику оператора в отношении обработки персональных данных, локальные акты по вопросам обработки персональных данных, а также локальные акты, устанавливающие процедуры, направленные на предотвращение и выявление нарушений законодательства Российской Федерации, устранение последствий таких нарушений, применяются правовые, организационные и технические меры по обеспечению безопасности персональных данных в соответствии со статьей 19 Федерального закона «О персональных данных», осуществляется внутренний контроль соответствия обработки персональных данных требованиям законодательства и принятым в соответствии с ним нормативными правовыми актам, требованиям к защите персональных данных, политике оператора в отношении обработки персональных данных, локальным актам оператора.

средства обеспечения безопасности: правовые, организационные, технические.

Категории персональных данных: фамилия, имя, отчество,год рождения,месяц рождения,дата рождения,место рождения,адрес,семейное положение,социальное положение,образование,профессия,доходы,состояние здоровья, ИНН, СНИЛС, Состав семьи, с указанием степени родства, фамилии, имени, отчества, года рождения ближайших родственников, Сведения об отношении к воинской службе, Вид работы (основной, по совместительству), Фотография, Сведения об аттестации (дата, решение, номер и дата документа, основание), Сведения о профессиональной подготовке (дата начала и окончания переподготовки, специальность (направление, профессия, наименование, номер, дата документа, свидетельствующего о переподготовке, основание переподготовки), Сведения о наградах, поощрениях, почетных званиях (наименование, номер, дата награды).

Категории субъектов, персональные данные которых обрабатываются: Работники, состоящие в трудовых отношениях с юридическим лицом, обучающиеся, родители(законные представители) обучающихся.

Перечень действий с персональными данными: Сбор, запись, систематизация, накопление, хранение, уточнение (обновление, изменение) извлечение, использование, передача (распространение, предоставление, доступ), обезличивание, блокирование, уничтожение, удаление.

Обработка персональных данных: смешанная,с передачей по сети Интернет

Правовое основание обработки персональных данных: Конституция РФ, Федеральный закон 27.07.2006 №152 ФЗ "О персональных данных", гл 14 ТК РФ, Федеральный закон от 29.12.2012 №273 ФЗ "Об образовании в РФ", письмо Минобрнауки РФ от 19.09.2014 №08-1316 "О внесении сведений в реестр операторов персональных данных", Устав МАОУ ДО "ДЮСШ г.Навашино" утв. постановлением Администрации г.о.Навашинский Нижегородской области от 22.11.2017 №1207.

Наличие трансграничной передачи: нет

Сведения о местонахождении базы данных: Россия

МАОУ ДО "ДЮЦ Г.НАВАШИНО" - ОГРН 1025201638043

6 марта 2001 года

Регистрация организации

27 ноября 2002 года

Присвоен ОГРН 1025201638043

5 ноября 2015 года

Сокращенное наименование организации изменено с МБОУ ДОД ДЮСШ Г. НАВАШИНО" на "МБОУ ДО "ДЮСШ"

Полное наименование организации изменено с МУНИЦИПАЛЬНОЕ БЮДЖЕТНОЕ ОБРАЗОВАТЕЛЬНОЕ УЧРЕЖДЕНИЕ ДОПОЛНИТЕЛЬНОГО ОБРАЗОВАНИЯ ДЕТЕЙ ДЕТСКО-ЮНОШЕСКАЯ СПОРТИВНАЯ ШКОЛА Г. НАВАШИНО" на "МУНИЦИПАЛЬНОЕ БЮДЖЕТНОЕ ОБРАЗОВАТЕЛЬНОЕ УЧРЕЖДЕНИЕ ДОПОЛНИТЕЛЬНОГО ОБРАЗОВАНИЯ "ДЕТСКО-ЮНОШЕСКАЯ СПОРТИВНАЯ ШКОЛА"

13 ноября 2015 года

Юридический адрес изменен с 607102, Нижегородская область, Навашинский район, г. Навашино, ул. 1 Мая, д. 6 на 607102, Нижегородская область, г. Навашино, ул. 1 Мая, д. 6

3 марта 2016 года

Юридический адрес изменен с 607102, Нижегородская область, г. Навашино, ул. 1 Мая, д. 6 на 607102, Нижегородская область, Навашинский район, г. Навашино, ул. 1 Мая, д. 6

25 января 2017 года

Изменения в составе учредителей
  Неуказанное муниципальное образование
  НИЖЕГОРОДСКАЯ ОБЛАСТЬ

31 января 2017 года

Изменения в составе учредителей
  Нижегородская область
  Неуказанное муниципальное образование

1 декабря 2017 года

Организационно-правовая форма организации изменена с Муниципальные бюджетные учреждения на Муниципальные автономные учреждения

Сокращенное наименование организации изменено с МБОУ ДО "ДЮСШ"" на "МАОУ ДО "ДЮСШ Г. НАВАШИНО"

Полное наименование организации изменено с МУНИЦИПАЛЬНОЕ БЮДЖЕТНОЕ ОБРАЗОВАТЕЛЬНОЕ УЧРЕЖДЕНИЕ ДОПОЛНИТЕЛЬНОГО ОБРАЗОВАНИЯ "ДЕТСКО-ЮНОШЕСКАЯ СПОРТИВНАЯ ШКОЛА"" на "МУНИЦИПАЛЬНОЕ АВТОНОМНОЕ ОБРАЗОВАТЕЛЬНОЕ УЧРЕЖДЕНИЕ ДОПОЛНИТЕЛЬНОГО ОБРАЗОВАНИЯ "ДЕТСКО-ЮНОШЕСКАЯ СПОРТИВНАЯ ШКОЛА Г.НАВАШИНО"

6 февраля 2020 года

Сокращенное наименование организации изменено с МАОУ ДО "ДЮСШ Г.НАВАШИНО"" на "МАОУ ДО "ДЮЦ Г.НАВАШИНО"

Полное наименование организации изменено с МУНИЦИПАЛЬНОЕ АВТОНОМНОЕ ОБРАЗОВАТЕЛЬНОЕ УЧРЕЖДЕНИЕ ДОПОЛНИТЕЛЬНОГО ОБРАЗОВАНИЯ "ДЕТСКО-ЮНОШЕСКАЯ СПОРТИВНАЯ ШКОЛА Г.НАВАШИНО"" на "МУНИЦИПАЛЬНОЕ АВТОНОМНОЕ ОБРАЗОВАТЕЛЬНОЕ УЧРЕЖДЕНИЕ ДОПОЛНИТЕЛЬНОГО ОБРАЗОВАНИЯ "ДЕТСКО-ЮНОШЕСКИЙ ЦЕНТР Г.НАВАШИНО"

4 июня 2020 года

Юридический адрес изменен с 607102, Нижегородская область, Навашинский район, г. Навашино, ул. 1 Мая, д. 6 на 607100, Нижегородская область, г. Навашино, ул. 1 Мая, д. 6

Лечебный Центр борется за пациентов. В это трудное время наш шанс

Эксперты поделили бизнес на две части: для одних открылись новые возможности и очередной кризис стал «точкой роста». Они масштабируются, получают приток новых клиентов и рост доходов. Во второй группе – те, кому повезло значительно меньше. Находясь в плоскости офлайн-активности, они не могут адаптироваться к новым реалиям. И уже понятно, что ждет в ближайшем будущем большинство таких компаний, у которых нет запаса прочности. Антикризисный план с потугами частично перейти в онлайн, провести оптимизацию и удержаться на плаву любым путем есть почти у всех, но реального результата по прогнозам достигнет даже не каждая пятая компания. 

Есть еще третья группа – это частная медицина. Хотим рассказать и показать вам в каких условиях она существует на примере ООО «Лечебный Центр». Мы не случайно выбрали именно это медицинское учреждение. Оно не относится к сетевым медицинским гигантам, но на рынке более 25 лет и сумело себя зарекомендовать. На такие клиники не распространяются формы государственной поддержки и разного рода субсидии по поддержке среднего и малого бизнеса. Но именно они работают в очень непростых условиях и продолжают делать главное – оказывать медицинскую помощь своим пациентам. 

На фоне вспышки короновируса болеть другими болезнями люди не перестали: есть пациенты с хроническими заболеваниями, наконец беременные женщины, медицинскую помощь которым нужно получать в любых условиях и ежедневно. Систему ДМС в сложной эпидобстановеке тоже никто не отменял.  

COVID-19 – это новая мировая проблема. И эта проблема прежде всего медицинская, а потом уже экономическая, социальная и т. д. Мы отправились во флагманское здание Лечебного Центра на Тимура Фрунзе, и прошли весь путь пациента от входа до кабинета врача.  

Необходимые меры безопасности в Лечебном Центре приняты с порога. При входе нас встретил представитель службы безопасности. Территория у входа разграничена на относительно безопасную дистанцию в полтора-два метра, которую настоятельно рекомендуется соблюдать пациентам, чтобы избежать инфицирования. Персонал использует средства индивидуальной защиты: медицинские маски, очки, одноразовые халаты и т. п. 

При входе дважды измеряют температуру тела. У нас с фотографом температура оказалась 36.6 °С. Мы «выдохнули» и отправились дальше, а заодно поинтересовались, что происходит с пациентами с повышенной температурой тела. Нам разъяснили, что они изолируются, проходят осмотр врача терапевта и после сбора эпиданамнеза направляются на диагностику. На сайте клиники размещено объявление, что в случаях повышения температуры тела пациентам настоятельно рекомендуется воспользоваться услугой вызов врача на дом. 

На что сразу обратили внимание – на каждом углу в клинике стоят диспенсеры с антисептическим средством для рук, проводится санитарная обработка всех помещений и кварцевание, клининг-служба работает в усиленном режиме. Главный врач Лечебного Центра – доктор медицинских наук Александр Васильевич Резайкин – лично обращается к пациентам с экранов внутреннего телевидения и по радио, просит соблюдать меры безопасности и подробно о них рассказывает. 

После открытия медицинской карты в регистратуре (оформили моментально), мы направились на прием. Не будем углубляться в подробности, но осмотром и рекомендациями врача наш фотограф остался доволен. 

После приема мы решили заглянуть в кафе. Посетителей мало, но они есть. Как нам рассказал официант, персонал клиники работает сменами по 14 часов, множество исследований лабораторной диагностики пациентам проводится натощак, поэтому закрыть кафе в медицинском учреждении не представляется возможным. Мы заказали комплексный обед – за очень демократичную цену нас накормили вкусной, а главное полезной едой. А самое главное, выдали набор средств индивидуальной защиты. Сдать после обеда попросили только очки – их отправляют на санитарную обработку и используют повторно.   

Мы провели в клинике около часа и убедились, что посещение медицинского учреждения может быть безопасным, если приняты все меры, и на них реально тратятся колоссальные финансовые средства. По завышенным ценам закупаются не только дезинфицирующие средства, но и расходные материалы (медицинские маски, перчатки и т. д.), которые необходимы в огромном количестве сотрудникам и пациентам. Осуществлена закупка аппаратов искусственной вентиляции легких для оказания экстренной медицинской помощи и проведения реанимационных мероприятий. За последний месяц стоимость такого медицинского оборудования выросла в несколько раз. Все это осуществляется на фоне резкого сокращения посещаемости пациентов, когда медицинский персонал фактически выполняет еще и функцию санитаров, и в ночное время занимается санитарной обработкой всех помещений клиники.    

Сегодня много говорят о социальной ответственности бизнеса перед обществом. Кто-то просто говорит и повышает свой рейтинг, а кто-то работает, и делает это в очень сложных эпидемиологических и экономических условиях.  

Малый и средний бизнес безусловно нуждается в поддержке со стороны государства, но и медицинский бизнес, нуждается в нем не меньше, независимо от своих масштабов и направлений медицинской деятельности. Каждый день медицинские и немедицинские сотрудники Лечебного Центра делают все от себя зависящие, чтобы пациенты получали необходимую медицинскую помощь в полном объеме. Чтобы продолжить свою работу таким клиникам необходима финансовая поддержка. 

Уже с 6 апреля пациенты смогут получить консультацию специалистов Лечебного Центра, не выходя из дома. Клиника начнет оказывать телемедицинские услуги с использованием мобильного приложения ЛЦ Телемед. Это позволит значительно сократить очные визиты в клинику и, в том числе, проводить большинство повторных приемов по результатам анализов в дистанционном формате. И это новые финансовые вложения, на этот раз в IT-инфраструктуру. 

В новых реалиях безусловно важно поддерживать театры, музеи, центры народных промыслов и другие объекты культуры и искусства. Но не менее важно обратить внимание на частные клиники, независимо от их размеров, которым нужны государственные и негосударственные субсидии, чтобы помогать людям здесь и сейчас. 

Прогностическое значение мутаций гена ТР53 при программном лечении больных острыми лейкозами Текст научной статьи по специальности «Фундаментальная медицина»

Александр Владимирович Виноградов', Алексей Васильевич Резайкин2, Александр Григорьевич Сергеев3

ПРОГНОСТИЧЕСКОЕ ЗНАЧЕНИЕ МУТАЦИЙ ГЕНА ТР53 ПРИ ПРОГРАММНОМ ЛЕЧЕНИИ БОЛЬНЫХ ОСТРЫМИ ЛЕЙКОЗАМИ

' К. м. н., научный сотрудник, центральная научно-исследовательская лаборатория ГБОУ ВПО Уральская государственная медицинская академия Минздрава России (620028, РФ, г. Екатеринбург, ул. Репина, д. 3) 2 Ассистент, кафедра микробиологии, вирусологии и иммунологии ГБОУ ВПО Уральская государственная медицинская академия Минздрава России (620028, РФ, г. Екатеринбург, ул. Репина, д. 3) 3 Д. м. н., профессор, заведующий, кафедра микробиологии, вирусологии и иммунологии; научный руководитель, лаборатория молекулярной диагностики ГБОУ ВПО Уральская государственная медицинская академия Минздрава России (620028, РФ, г. Екатеринбург, ул. Репина, д. 3)

Адрес для переписки: 620028, РФ, г. Екатеринбург, ул. Репина, д. 3, УГМА, ЦНИЛ, Виноградов Александр Владимирович; e-mail: [email protected]

Проанализированы частота, структурные особенности и прогностическое значение мутаций гена ТР53 при острых миелоидных и лимфобластных лейкозах. Детекцию мутаций осуществляли с использованием метода прямого автоматического секвенирования. Установлено, что средняя частота мутаций ТР53 при остром миелобластном лейкозе составляет 9,7% и различается в зависимости от цитоге-нетического варианта и наличия других генетических аномалий. Максимальная частота мутаций ТР53 (60%) выявлена при остром миелобластном лейкозе с комплексными хромосомными аберрациями. 250G>T экзона 4 гена ТР53 с повреждениями экзона 2 гена CDKN2A/ARF. Прогноз программного лечения острых лейкозов с мутациями ТР53 был крайне неблагоприятным: медиана общей продолжительности жизни пациентов не превышала 3 мес.

Ключевые слова: ген ТР53, мутация, острый миелоидный лейкоз, острый лимфобластный лейкоз, секвенирование.

Ген ТР53, кодирующий опухолевый супрессор, расположен на коротком плече 17-й хромосомы (район 17р13.1), состоит из 11 экзонов и имеет протяженность 19144 нуклеотидных пар. Основной мРНК-транскрипт гена длиной 2586 нуклеотидов включает 5'-нетрансли-руемый регион, соответствующий экзонам 1 и 2, 3'-не-транслируемый регион, соответствующий экзону 11, и кодирующую последовательность, считывающуюся с экзонов 2—11 и транслируемую в белковый продукт, содержащий 393 аминокислотных остатка. Кодируемый геном белок р53 экспрессируется во всех тканях организма и формирует связывающиеся с ДНК гомотетрамеры. Период полураспада белка составляет около 20 мин, так как в нормальных условиях он подвергается зависимой от MDM2 и опосредованной убиквитином протеасомной деградации. Стабилизация белкового продукта достигается при определенных условиях за счет посттрансляционных модификаций полипептида — фосфорилирова-

© Виноградов А. В., Резайкин А. В., Сергеев А. Г., 2013 УДК 616-006.446-037:575.24/.25

ния, ацетилирования, метилирования, SUMOилирования и NEDDилирования [1—4].

Белок р53 является транскрипционным фактором и вызывает опухолевую супрессию посредством регуляции экспрессии генов, приводящих либо к остановке клеточного цикла в сверочных точках G1/S и S/G2, либо к программируемой гибели клетки (апоптозу). В структуре полипептида р53 выделяют домены: трансактивацион-ный (аминокислотные остатки 1—64), пролиновый (63— 97) и ДНК-связывающий (94—292), — а также сигнал ядерной локализации (305—322) и олигомеризационный (319—359) и основной/репрессорный домены (360—393). Связывание гомотетрамеров р53 с ДНК происходит в участках, содержащих палиндромную последовательность

PuPuPuC(A/T)(A/T)GPyPyPy-(Nn)-PuPuPuC(A/T)(A/T)GPyPyPy, где Pu — пурины, а Py — пиримидины [1—4].

Мутациями гена ТР53 сопровождаются более 50% злокачественных новообразований, в том числе лейкозы и лимфомы. Мутации в основном представлены несинони-

мичными нуклеотидными заменами, приводящими к нарушению связывания белка с ДНК [4; 5]. Тем не менее до недавнего времени роль гена ТР53 в патогенезе острых лейкозов (ОЛ) представлялась неопределенной. Ее связывали главным образом с развитием вторичных опухолей, плохо поддающихся программной полихимиотерапии. Патогенез первичных острых миелоидных лейкозов (ОМЛ) объясняла двухшаговая модель, отводившая ключевую роль в злокачественной трансформации клеток-предшественниц гемопоэза продуктам химерных генов, мутантным тирозинкиназам, а также точковым мутациям генов CEBPA и NPM1 [6—9]. Однако за последние 3 года рядом исследователей была установлена повышенная частота мутаций гена ТР53 при ОМЛ с комплексными хромосомными аберрациями [10; 11]. Этими учеными предложена модель прогностической стратификации, базирующаяся на детекции молекулярных поломок, в том числе аномалий ТР53 [12]. В соответствии с ней мутации гена ТР53 определялись у 9,5% больных ОМЛ и были ассоциированы с крайне неблагоприятным прогнозом. Несмотря на это, клинико-диагностическое значение мутаций гена ТР53 при ОЛ остается неопределенным, в том числе при различных морфологических и иммунофено-типических вариантах ОЛ, а также при сочетании мутаций гена ТР53 с другими молекулярно-генетическими и хромосомными аномалиями [4; 11; 12].

Цель исследования — определить частоту, структурные особенности и прогностическое значение мутаций гена ТР53 при ОЛ в зависимости от морфологического варианта и цитогенетического статуса, а также наличия комбинированных повреждений генов FLT3, NPM1, KIT, N-RAS, WT1 и CDKN2A/ARF.

МАТЕРИАЛЫ И МЕТОДЫ

Исследованы пробы костного мозга и периферической крови больных ОЛ (n = 91), которые проходили программное лечение в Свердловском областном онкоге-матологическом центре (г. Екатеринбург) в период с 2008 по 2012 г. Из всех обследованных больных у 72 был ОМЛ, у 19 — острый лимфобластный лейкоз (ОЛЛ). Средний возраст пациентов с ОМЛ составил 55,3 ± 3,5 года, с ОЛЛ — 35,7 ± 6,9 года. Доля больных в возрасте 60 лет или старше составила при ОМЛ 48,6%, при ОЛЛ — 5,3%.

Диагностику ОЛ осуществляли, в соответствии с рекомендациями ВОЗ, на основании клинической картины и анализа крови и костного мозга, а также на основании цитохимического и иммунофенотипического исследования бластных клеток [13]. По показаниям выполняли трепанобиопсию подвздошной кости с последующим гистологическим и иммуногистохимическим исследованием. Морфологический вариант ОМЛ определяли в соответствии с франко-американо-британской (FAB) классификацией. Вариант М0 по FAB-классификации был выявлен у 3 пациентов, М1 — у 5, М2 — у 32, М3 — у 6, М4 — у 18, М4эо — у 3, М5 — у 1, М6 — у 3, острый миелофиброз (ОМФ) — у 1 пациента. Диагностику варианта ОЛЛ выполняли в соответствии с рекомендациями ВОЗ [13]. Иммунофенотипический вариант BI был определен в 6 случаях, В11 — в 9 случаях. На долю В!У, TI, TII и недифференцированного ОЛЛ пришлось по одному наблюдению.

Программное лечение больных ОЛ проводили по протоколам, разработанным Российской группой по изучению острых лейкозов [14]. В основе всех исследовательских протоколов лежал принцип интенсивной индукции-консолидации ремиссии с последующей по-стремиссионной поддерживающей полихимиотерапией. Основой программного лечения ОМЛ являлось комбинированное назначение на этапе индукции-консолидации циторабина и антрациклиновых антибиотиков (протоколы ОМЛ 06. 06, ОМЛ 01.10, протокол программной химиотерапии для больных старше 60 лет). При остром промиелоцитарном лейкозе использовали протоколы ОПЛ 01.08 и AIDA, включавшие также полностью транс-ретиноевую кислоту. Больным ОЛЛ лечение проводили либо по протоколу «ALL-2009» (для лиц моложе 55 лет), либо винкристином в сочетании с преднизолоном, а при иммунофенотипе ОЛЛ BIV — блоками А и С по протоколу «ЛБ-М-04» [14].

В исследуемой группе всем пациентам выполнено цитогенетическое и/или молекулярно-генетическое исследование (полимеразная цепная реакция — ПЦР), прямое автоматическое секвенирование экзонов 4—11 гена ТР53 [15]. Кроме того, у больных ОМЛ в 63 пробах для выявления мутаций исследованы экзоны 12—15 и 19—21 гена FLT3, в 48 пробах — экзоны 9—12 гена NPMl, в 44 пробах — экзоны 7—12 и 16—19 гена KIT, в 32 пробах — экзоны 1—4 гена N-RAS, в 34 пробах — экзоны 6—9 гена WTl [16]. При ОЛЛ в 9 пробах исследованы мутации экзонов 1—2 гена CDKN2A, а также выполнен анализ альтернативной рамки считывания гена ARF, перекрывающейся с кодирующей последовательностью CDKN2A в области экзона 2 [17; 18]. Праймеры, фланкирующие участки кДНК, которые соответствуют перечисленным экзонам указанных генов, разработаны с использованием депонированных в GenBank нуклеотидных последовательностей (табл. 1) [16].

Секвенирование ДНК проводили на автоматическом генетическом анализаторе ABI Prism 310 с использованием реакционной смеси ABI Prism BigDye Terminator Cycle Sequencing Kit v.3.0 («Applied Biosystems», США). Сопоставление сегментов, выравнивание и сравнение последовательностей нуклеотидов и аминокислот проводили с использованием компьютерной программы MEGA, версия 3.1.

Статистическую обработку данных проводили на ЭВМ с помощью программы «Генанализ». Для проверки статистических гипотез использовали точный критерий Фишера. Доверительные интервалы (ДИ) для средних частот мутаций гена ТР53 определены с вероятностью 95% на основе биномиального распределения. Оценку взаимозависимости молекулярных повреждений TP53 и CDKN2A/ ARF, выявляемых в одной пробе одновременно, проводили посредством сравнения ожидаемой частоты, рассчитанной по формуле для независимых событий, с частотой, наблюдаемой в исследуемой выборке. Если при сопоставлении расчетной и наблюдаемой частот выявляли совпадение, то считали мутации независимыми. Если наблюдаемая частота отличалась от расчетной при уровне значимости р = 0,05, то события признавали взаимозависимыми. Вероятностную выживаемость пациентов оценивали с помощью актуариального метода по Каплану—Мейеру.

Таблица 1

Последовательности праймеров, использованные для амплификации и секвенирования исследуемых участков генов CDKN2A, FLT3, KIT, NPM1, N-RAS, TP53, WT1

Анализ биологической значимости мутаций гена ТР53, в том числе влияния аминокислотных замен и деле-ций на структуру и функцию кодируемого белка, проводили с использованием инструментов и протоколов баз данных IARC TP53 Database (R16, November 2012) [19] и The TP53 UMD mutation database in human cancer (2012 release) [5]. Мутации генов CDKN2A и ARF исследовали с помощью UVM BioDesktop CDKN2a Database [18].

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ

Установлено, что функционально значимые, т. е. приводящие к снижению активности кодируемого белка, мутации гена ТР53 при острых миелоидных и лимфобласт-ных лейкозах выявлялись с частотой 9,7% (при 95% ДИ от 4,3 до 19,2%) и 21,1% (при 95% ДИ от 8,1 до 43,7%) соответственно. В случае ОМЛ эти мутации определялись при морфологических вариантах М2 (n = 4), М4 (n = 1) и М6 (n = 2), при ОЛЛ — при иммунофенотипических вариантах В1 (n = 2), В4 и Т1 (по одному случаю), что можно объяснить малым объемом исследуемой выборки.

Результаты детекции мутаций экзонов 4—11 гена ТР53 при ОМЛ в зависимости от цитогенетического и морфологического варианта представлены в табл. 2. Оказалось, что частота мутаций достоверно различалась в различных цитогенетических подгруппах ОМЛ и была максимальной при комплексных хромосомных аберрациях (60%). При этом в 3 случаях из 6 указанные аномалии кариотипа включали перестройки короткого плеча 17-й хромосомы. Лишь в одном наблюдении при ОМЛ М2 транзиция c.377A>G обнаруживалась в лейкоз-ных бластах с нормальным кариотипом (5%; р = 0,003). Средний возраст больных ОМЛ с мутациями гена ТР53 составил 62,6 ± 2,5 года.

Случаев одновременной детекции мутаций ТР53 и других специфических генетических аномалий, таких, как транслокации t(8;21), t(15;17), t(9;22), t(3;3), t(6;11), t(11;19) и инверсия inv(16), при ОМЛ не зафиксировано (p = 0,001). Мутации гена ТР53 не определялись и у пациентов с прочими структурными и количественными хромосомными аберрациями (p = 0,005). В одном случае при остром эритромиелозе с комплексными хромосомными аберрациями и расщеплением на 4 субклона с различными цитогенетическими характеристиками предположено наличие в 3 из них Ph-хромосомы, однако при ПЦР-анализе химерные транскрипты BCR-ABL не обнаруживались.

При параллельном исследовании проб на ТР53 и другие прото- и антионкогены методом прямого секвениро-вания не удалось выявить кооперации мутаций гена ТР53 с повреждениями генов FLT3 (экзоны 12—15 и 19—21), NPM' (экзоны 9—12), KIT (экзоны 7—12 и 16—19), N-RAS (экзоны 1—4) и WT' (экзоны 6—9), в то время как указанные кооперации выявлялись у 12,7; 14,6; 6,8; 12,5 и 3,2% больных ОМЛ соответственно (р = 0,0002).

В одном случае при ОМЛ М2эо с кариотипом 45, XY, del(2)(q), iso(9)(q), r(12), del(17)(q), add(19)(p), -15 одновременно определялись две несинонимичные транзиции кодирующей последовательности гена ТР53 — c.292C>T и c.817C>T. Первая из них обусловливала аминокислотную замену p.98P>S, т. е. замену пролина на серин в 98-й позиции пролинового домена белка р53, вторая —

Название Последовательность

FLT-ITD-F б' TGT TCAGAC AAG TCT CCC AAC TGC 3'

FLT-ITD-R б' CAT CTT GAG TTC TGA CAT GAG TGC C 3'

FLT-TK-F 5' AAG ATC TTC TTT GCT TTG CAT ATC A 3'

FLT-TK-R 5' GGA ATG CCA GGG TAA GGA TT 3'

KIT1-F 5' CCG AAG GAG GCA CTT ACA C 3'

KIT1-R 5' GCA GGC TCC AAG TAG ATT CA 3'

KIT2-F 5' CAA CCA AGG CCG ACA A 3'

KIT2-R 5' ACT TAG AAT CGA CCG GCA TT 3'

KIT1-SF 5' TCA ATG CTG CCA TAG 3'

KIT2-SF 5' TGA CTC CCG CCA TCA 3'

KN-F 5' GCGTCCCCTTGCCTGGAAAGATACC 3'

KN-R 5' TGAGGGACCTTCCGCGGCATCTAT 3'

KN-SF 5' ACAGGGTCGGAGGGGGCTCT 3'

KN-SR 5' GCATCTATGCGGGCATGGTT 3'

NPM1-F 5' AGGAAGCTGAAGAAAAAGCG 3'

NPM1-R 5' GGACAGCCAGATATCAACTG 3'

NPM1-S1 5' GGACAAGAATCCTTCAAGAA 3'

NRAS-F 5' GTT CAT GGC GGT TCC 3'

NRAS-R 5' GGC GTA TTT CTC TTA CCA GT 3'

NRAS-S 5' CGG CTG TGG TCC TAA ATC TG 3'

P53-F 5' AGTCAG ATC CTAGCG TCG AG 3'

P53-R 5' TGG CGG GAG GTA GAC TG 3'

P53-S1 5' ACA TTT TCA GAC CTA TGG AA 3'

P53-S2 5' GCG CCA TGG CCA TCT ACA AG 3'

P53-S3 5' ACC CTT TTT GGA CTT CAG GT 3'

WT1-F 5' ACC CAG GCT GCA ATA AGA 3'

WT1-R 5' AGG AGG AGT GGA GAG TCA GA 3'

WT1-S 5' TAA GCT GTC CCA CTT ACA GA 3'

Таблица 2

Результаты детекции мутаций гена ТР53 при ОМЛ

Морфологический Число пациентов

классификации FAB Кариотип всего/мутантный ТР53 полиморфизм С215G значимые мутации синонимичные замены

Нормальный 1/0 1 0 0

МО Неизвестен 2/0 2 0 0

Всего МО 3/0 3 0 0

Нормальный 2/0 2 0 0

М1 +8 1/0 1 0 0

Неизвестен 2/0 2 0 0

Всего М1 5/0 5 0 0

Нормальный 8/1 3 1 0

1(8;21) 2/0 2 0 0

ту(16) 1/0 1 0 0

1(3;3) 1/0 1 0 0

1(б;11) 1/0 1 0 0

1(9;22) 1/1 0 0 1

М2 1(7) 1/0 1 0 0

+8 2/0 2 0 0

+8, +21 1/0 1 0 0

+ 13 1/0 1 0 0

-У 1/0 1 0 0

Комплексные 5/3 4 3 0

Неизвестен 7/0 6 0 0

Всего М2 32/5 24 4 1

М3 1(15;17) 6/0 6 0 0

Нормальный 9/1 8 0 1

ту(16) 1/0 1 0 0

ту(9) 1/0 1 0 0

М4 -5 1/0 1 0 0

Комплексные 2/1 2 1 0

Неизвестен 4/0 3 0 0

Всего М4 18/2 16 1 1

Таблица 2 (окончание)

ту(16) 1/0 1 0 0

М4эо 1(11;19) 1/0 1 0 0

+8 1/0 1 0 0

Всего М4эо 3/0 3 0 0

М5 Нормальный 1/0 0 0 0

М6 Комплексные 3/2 0 2 0

ОМФ Неизвестен 1/0 1 0 0

Всего ОМЛ 72/9 58 7 2

замену аргинина на цистеин в позиции 273 (p. 273R>C) ДНК-связывающего домена. В остальных случаях были выявлены одиночные мутации, также приводившие к изменениям структуры ДНК-связывающего домена и инактивации белка р53. Эти мутации были представлены тремя транзициями (c.377A>G, c.659A>G, с.817С>Т), двумя трансверсиями (c.733G>T, с.84Ю>Т) и одной мутацией со сдвигом рамки считывания за счет делеции тимидина в позиции 645 (c.645delG) кодирующей последовательности ТР53. При этом мутации с.292С>Т (экзон 4), c.377A>G (экзон 5), c.645delG (экзон 6) и с.84Ю>Т (экзон 8) выявлены при ОМЛ впервые. Нуклеотидные замены c.659A>G (экзон 6), c.733G>T (экзон 7) и с.817С>Т (экзон 8) описаны в литературе и соответствуют «горячим точкам» кодирующей последовательности ДНК-связывающего домена, представленным в том числе CpG-динуклеотидами (c.733G>T и с.817С>Т) [5; 19; 20]. Кариотипы лейкозных клеток пациентов с указанными аномалиями приведены в табл. 3. Таким образом, наиболее частой мутацией гена ТР53 при ОМЛ оказалась транзиция с. 9;22) по малому кластеру разрыва (т-Ьсг) в интроне 1 гена BCR, обусловливающей синтез мутантной тирозинкина-зы р190; в другом случае — при ОМЛ М4 без выявленных хромосомных и молекулярных повреждений.

Несинонимичная замена c.215C>G, которая рассматривается в качестве полиморфного аллеля гена [3; 5; 19] и сопровождается аминокислотной заменой p.72P>R,

определялась в 58 (80,6%) пробах, в том числе изолированная — в 56 (77,8%) пробах. Последовательность мРНК ТР53 «дикого» типа, соответствующая NM_000546, GenBank NCBI, определялась при ОМЛ у 9 (12,5%) больных.

Средняя частота трансверсии c.215C>G при ОЛЛ составила 73,7% (п = 14), в том числе изолированной — 68,4% (п = 13). Синонимичных нуклеотидных замен экзонов 4—11 гена ТР53 при ОЛЛ не выявлено, что может быть обусловлено малым объемом выборки.

Функционально значимые мутации в экзонах 4—11 гена ТР53 определялись у 4 больных ОЛЛ в возрасте 24, 30, 32 и 73 лет и были представлены, соответственно, несинонимичными нуклеотидными заменами c. 9;22) (п = 4) и Щ;19) (п = 1) мутации ТР53 не определялись.

В одной пробе при ОЛЛ Т1 с нормальным кариоти-пом бластов и трансверсией c.250G>Т экзона 4 гена ТР53 одновременно определялась делеция экзонов 1 и 2 гена CDKN2A протяженностью 202 нуклеотида со 134-й по 335-ю позицию от начала кодирующей последовательности, приводящая к сдвигу рамки считывания и инактивации кодируемого белка. Эта же делеция затрагивала ген ARF, мРНК которого кодируется экзоном 2 гена CDKN2A, но транслируется со смещением на — 1 нуклеотидную позицию [17; 18]. Это свидетельствует в пользу возможной кооперации мутантных продуктов генов ТР53 и CDKN2A/ ARF при злокачественной трансформации лейкозных клеток при ОЛЛ. Среди проб с последовательностью мРНК ТР53 «дикого» типа или полиморфным аллелем c.215C>G мутации гена CDKN2A выявлены в 3 случаях

Таблица 3

Варианты цитогенетических изменений при ОЛ с функционально значимыми мутациями экзонов 4—8 гена ТР53

Мутация гена ТР53 (вариант дефекта белка) Кариотип Вариант ОМЛ или ОЛЛ

ОМЛ

c. 292C>T (p.98P>S), c.817C>T (p.273R>C) 45, XY del(2)(q), iso(9)(q), r(12), del(17)(q), add(19)(p), -15 М2эо

c.377A>G (p.126Y>C) 46, ХХ М2

c.645delG (фреймшифт) 47, XY del(3)(p12), del(5)(q31), add(17)(p13), -7, +21, +mar М2

c.659A>G (p.220Y>C) 46, ХХ, del(5q)(3.2), add(18p)(1.1.3) or t(5;18)(q2.3;p1.1)[6]/ 46, ХХ, del(17p) (1.2), add(18p)(1.1.3) or t(17;18)(p1.2;p1.1)[3]/ 47, ХХ, del(5q)(3.2), add(18p) (1.1.3) or t(5;18)(q2.3;p1.1), +mar[2]/ 46, ХХ[2] М6

c.733G>T (p.245G>C) 52, XYY, inv(3)(p12;q24), +1, +9, +11, +13, +19, +Y +mar М4

c.817C>T (p.273R>C) 40—45, XY del(4)(p14), -5, dup(7)(q11;q22), del(11)(q21), del(17)(p12), -19, +Ph, +mar 1—4[7]/ 41—45, XY del(4)(p14), -5, del(6)(q23), dup(7)(q11;q22), del(11) (q21), +Ph, +mar 1—3[6]/ 40—45, XY del(4)(p14), -5, dup(7)(q11;q22), del(11) (q21), inv(17)(q21;q25), -19, +Ph, +mar 1—4[5]/ 44, XY del(4)(p14), -5, dup(7) (q11;q21), -19, +Ph[2]a М6

c.

Прогноз при ОЛЛ с наличием мутаций гена ТР53 был неблагоприятный. В 3 случаях (ОЛЛ В1, В11, Т1) пациенты оказались резистентными к программной полихимиотерапии, в одном наблюдении (ОЛЛ ВГУ", c.473G>A) была достигнута клинико-гематологическая ремиссия после первого блока полихимиотерапии по программе «ЛБ-М-04» [15], однако ее продолжительность составляла менее 6 мес. Медиана общей продолжительности жизни больных ОЛЛ с мутациями гена ТР53 не превышала 3 мес. В группе сравнения (больные ОЛЛ без мутаций гена ТР53) годичная вероятностная выживаемость составила 43,2 ± 13,6%, медиана общей продолжительности жизни — 7 мес.

ВЫВОДЫ

1. Частота мутаций в экзонах 4—11 гена ТР53 при ОМЛ в обследованной группе пациентов составила 9,7% и различалась в зависимости от кариотипа лейкозных бластов и наличия генетических аномалий в других исследованных прото- и антионкогенах.

2. Мутации гена ТР53 с высокой частотой (60%) определялись при ОМЛ с комплексными хромосомными аберрациями и не встречались при наличии других специфических молекулярных повреждений.

3. Частота аномалий гена ТР53 при ОЛЛ составляла 21,1%, при этом мутации были ассоциированы с диплоидным кариотипом, а также с повреждениями CDKN2A/ARF.

4. Наличие мутаций в гене ТР53 определяло неблагоприятный прогноз программного лечения в обследованной группе больных ОЛ. Медиана общей продолжительности жизни пациентов с мутантным р53 не превышала 3 мес.

ЛИТЕРАТУРА

1. Барлев Н. А. Роль сайт-специфического ацетилирования и метилирования в регуляции онкосупрессора р53 у человека: Дис... д-ра биол. наук. — СПб., 2009. — 142 с.

2. Многоликий р53: разнообразие форм, функций, опухоль-супрессирующих и онкогенных активностей / Копнин Б. П., Коп-нин П. Б., Хромова Н. В., Агапова Л. С. // Клин. онкогематол. — 2008. — Т. 1, №1. — С. 2—9.

3. Чумаков П. М. Белок р53 и его универсальные функции в многоклеточном организме // Успехи биол. хим. — 2007. — Т. 47. — С. 3—52.

4. Dysfunction of the TP53 tumor suppressor gene in lymphoid malignancies / Xu-Monette Z. Y., Medeiros L. J., Li Y., Orlowski R. Z., Andreeff M., Bueso-Ramos C. E., Greiner T. C., McDonnell T. J., Young K. H. // Blood. — 2012. — Vol. 119. — P. 3668—3683.

5. Data-driven unbiased curation of the TP53 tumor suppressor gene mutation database and validation by ultradeep sequencing of human tumors / Edlund K., Larsson O., Ameur A., Bunikis I., Gyllensten U., Leroy B., Sundstrom M., Micke P., Botling J., Soussi T. // Proc. Natl. Acad. Sci. USA. — 2012. — Vol. 109. — P. 9551—9556.

6. Comprehensive analysis of cooperative gene mutations between class I and class II in de novo acute myeloid leukemia / Ishikawa Y., Ki-yoi H., Tsujimura A., Miyawaki S., Miyazaki Y., Kuriyama K., Tomona-ga M., Naoe T. // Eur. J. Haematol. — 2009. — Vol. 83. — P. 90—98.

7. Cooperating gene mutations in acute myeloid leukemia: a review of the literature / Renneville A., Roumier C., Biggio V., Nibourel O., Bois-sel N., Fenaux P., Preudhomme C. // Leukemia. — 2008. — Vol. 22. — P. 915—931.

8. Myeloid malignancies: mutations, models and management / Murati A., Brecqueville M., Devillier R., Mozziconacci M. J., Gelsi-Boy-er V., Birnbaum D. // BMC Cancer. — 2012. — Vol. 12. — P. 304.

9. Takahashi S. Current findings for recurring mutations in acute myeloid leukemia // J. Hematol. Oncol. — 2011. — Vol. 4. — P. 36.

10. A comparative analysis of TP53 gene mutations in acute myeloid and lymphoblastic leukemia patients / Vinogradov A. V., Rezaikin A. V., Sergeev A. G., Konstantinova T. S., Sveshnikova J. V., Sharov L. N., Vino-gradova N. V. // Cel. Ther. Transplantat. — 2011. — Vol. 3, N 11. — P. 114.

11. TP53 alterations in acute myeloid leukemia with complex karyotype correlate with specific copy number alterations, monosomal karyotype, and dismal outcome / Rücker F. G., Schlenk R. F., Bullinger L., Kayser S., Teleanu V., Kett H., Habdank M., Kugler C. M., Holzmann K.,

Gaidzik V. I., Paschka P., Held G., von Lilienfeld-Toal M., Lubbert M., Frohling S., Zenz T., Krauter J., Schlegelberger B., Ganser A., Lichter P., Dohner K., Dohner H. // Blood. — 2012. — Vol. 119. — P. 2114—2121.

12. A novel hierarchical prognostic model of AML solely based on molecular mutations / Grossmann V., Schnittger S., Kohlmann A., Eder C., Roller A., Dicker F., Schmid C., Wendtner C. M., Staib P., Serve H., Kreuzer K. A., Kern W., Haferlach T., Haferlach C. // Blood. — 2012. — Vol. 120. — P. 2963—2972.

13. WHO classification of tumors of haematopoietic and lymphoid tissues / Swerdlow S. H., Campo E., Harris N. L., Jaffe E. S., Pileri S. A., Stein H., Thiele J., Vardiman J. W. — Lyon: IARC, 2008. — 439 p.

14. Программное лечение заболеваний системы крови // Сборник алгоритмов диагностики и протоколов лечения заболеваний системы крови / Под ред. В. Г. Савченко. — М.: Практика, 2012. — 1056 с.

15. Vinogradov A. V., Rezaikin A. V., Sergeev A. G. TP53 gene point mutation detection using sequencing techniques in acute and chronic leukemia patients // Cel. Ther. Transplantat. — 2010. — Vol. 3, N 9. — P. 126.

16. Виноградов А. В., Резайкин А. В., Сергеев А. Г. Комплексное исследование мутаций генов TP53, FLT3, KIT, N-RAS, NPM1 и WT1 при острых миелоидных лейкозах с использованием технологии прямого секвенирования // Биомика. — 2012. — Т. 3, №1. — С. 22—24.

17. Larsen C. J. Contribution of the dual coding capacity of the p16INK4a/MTS1/CDKN2 locus to human malignancies // Progress in Cell Cycle Res. — 1997. — Vol. 3. — P. 109—124.

18. The CDKN2A database: Integrating allelic variants with evolution, structure, function, and disease association / Murphy J. A., Bar-rantes-Reynolds R., Kocherlakota R., Bond J. P., Greenblatt M. S. // Hum. Mutat. — 2004. — Vol. 24. — P. 296—304.

19. Impact of mutant p53 functional properties on TP53 mutation patterns and tumor phenotype: lessons from recent developments in the IARC TP53 database / Petitjean A. , Mathe E., Kato S., Ishioka C., Tavtig-ian S. V., Hainaut P., Olivier M. // Hum. Mutat. — 2007. — Vol. 28. — P. 622—629.

20. Soussi T., Beroud C. Significance of TP53 Mutations in Human Cancer: A Critical Analysis of Mutations at CpG Dinucleotides. // Hum. Mutat. — 2003. — Vol. 21. — P. 182—200.

Поступила 22.01.2013

Alexander Vladimirovich Vinogradov1, Alexey Vasilievich Rezaikin2, Alexander Grigorievich Sergeyev3

PROGNOSTIC IMPACT OF TP53 MUTATIONS IN THE TREATMENT OF ACUTE LEUKEMIA

' MD, PhD, Researcher, Central Research Laboratory, Ural State Medical Academy (3, ul. Repina, Ekaterinburg, RF, 620028) 2 MD, Assistant, Chair of Microbiology, Virology and Immunology, Ural State Medical Academy (3, ul. Repina, Ekaterinburg, RF, 620028) 3 MD, PhD, DSc, Professor, Head, Chair of Microbiology, Virology and Immunology; Scientific Director, Central Research Laboratory, Ural State Medical Academy (3, ul. Repina, Ekaterinburg, RF, 620028)

Address for correspondence: Vinogradov Alexander Vladimirovich, Central Research Laboratory, Ural State Medical Academy, 3, ul. Repina, Ekaterinburg, RF, 620028;

e-mail: [email protected]

The paper analyzes frequency, structural features and prognostic impact of TP53 mutations in acute myeloid and lymphoblastic leukemias. The mutations were detected by direct automatic sequencing. Average frequency of TP53 mutations in acute myeloblastic leukemia was 9.7% and varied in different cytogenetic disease types and in the presence of other genetic abnormalities. Frequency of TP53 mutations reached maximum (60%) in acute myeloblastic leukemia with complex chromosomal aberrations. There was no damage in TP53 exons 4 to 11 in acute myeloblastic leukemia with expression of specific chimeric genes and/or mutations of FLT3, NPM', KIT, N-RAS, WT. Frequency of TP53 mutations in acute lymphoblastic leukemia was 21.1% and all these cases belonged to diploid karyotype. Cooperation of c.250G>T transversion of TP53 exon 4 with damage in exon 2 of CDKN2A/ARFwas detected in one case. Acute leukemias with TP53 mutations had very poor prognosis with median survival not exceeding than 3 months.

Key words: gene TP53, mutation, acute myeloid leukemia, acute lymphoblastic leukemia, sequencing.

О Диагностическом центре

О Диагностическом центре

На сегодняшний день ГБУЗ НО «Клинический диагностический центр» – это мощный многопрофильный лечебно-диагностический комплекс. На протяжении 30 лет центр остается ведущим учреждением оказания высококвалифицированной медицинской помощи в Нижегородской области. Высокая компетентность и профессионализм наших специалистов, подкрепленные обновленной материально-технической базой центра, позволяют с высокой точностью проводить обследования и осуществлять диагностику заболеваний в любых самых сложных случаях. В штате диагностического центра кандидаты медицинских наук, врачи высшей категории, имеющие серьезный опыт работы и владеющие современными методиками диагностики и лечения.

Потенциал Диагностического центра обеспечивает всестороннее комплексное обследование пациента. Диагностический центр – гарантия качества медицинской помощи.

 

История

В декабре 1989 года в Нижнем Новгороде (в то время - г. Горьком) приказом начальника Управления здравоохранения области Резайкина Василия Ивановича был открыт Областной медицинский диагностический центр.

Проект был выполнен коллективом института "Промстройпроект", возглавляемый директором Бакаевым Алексеем Ивановичем.

Главным архитектором проекта Осиным Юрием Платоновичем был создан ансамбль зданий по улице Решетниковской. В этот ансамбль вошло и высотное белое здание Диагностического центра. На месте заболоченной низины речки Студеной появились современные архитектурные сооружения.

Особая роль в создании Центра принадлежит главному технологу проекта Миллеру Абраму Мовшеевичу. Именно ему, сотруднику института "Горьковгражданпроект" была поручена очень ответственная часть проекта, от качества выполнения которой зависела технология работы будущего медицинского персонала Центра. Особенностью создания центра в кратчайшие сроки была необходимость одновременного проектирования и его строительства.

Основная заслуга в решении и создании Диагностического центра принадлежала председателю Облисполкома Нижегородской области Соколову Александру Александровичу. Именно он брал на себя всю ответственность за проектирование и строительство, именно он и его заместитель Втюрин Алексей Васильевич находили время и проводили еженедельные заседания штаба стройки.

Работали все - проектанты и строители, снабженцы и медицинские работники. Усилиями всех удалось за два года - с 1987 по 1989 - спроектировать, построить, оснастить и запустить в работу Диагностический центр.
Центр еще строился, а начальник управления здравоохранения Нижегородского облисполкома Резайкин Василий Иванович решил кадровые вопросы ОМДЦ. Появилась администрация нашего учреждения, которую возглавил будущий главный врач Будилин Сергей Владимирович. Первые врачи Центра поехали учиться новому делу в ведущие клиники Москвы, Ленинграда, Казани.

Наконец строители сдают здание для эксплуатации с оценкой "хорошо". Персоналу Центра была поставлена главная задача - в кратчайшие сроки смонтировать оборудование и освоить методики диагностического процесса. Со стороны Управления здравоохранения контроль за работой Диагностического центра в этот период был возложен на заместителя начальника Управления Позднякова Александра Даниловича. Полученное оборудование после монтажа в течении нескольких дней вводилось в эксплуатацию. В декабре 1989 года были приняты первые пациенты.

В организации работы НОМДЦ активно участвовали и проявили себя заместители главного врача: Шаров Юрий Геннадьевич, Макаренко Константин Игоревич, Бабикова Людмила Николаевна, Кушников Олег Иванович.

Огромный вклад в развитие диагностического процесса внесли заведующие медицинскими подразделениями Центра: Парфентьев Валерий Александрович, Ильичев Дмитрий Геннадьевич, Сиднев Борис Николаевич, Горохова Зоя Александровна, Шаленков Вадим Петрович, Николаев Николай Иванович, Саранцев Борис Валентинович, Удалова Ольга Васильевна, Дубкова Тамара Сергеевна, Казанский Александр Сергеевич, Шарапова Марина Евгеньевна.

С открытием Диагностического центра в нашем городе была решена задача обеспечения современного уровня медицинской диагностики и создана материально-техническая база для полноценного обследования населения на догоспитальном этапе. И сегодня, спустя 30 лет, центр эффективно работает и постоянно набирает обороты. .

Dorogi fióktelep: 2510 Dorog, Esztergomi út 27. Postacím: 2511 Dorog, Pf. 26. Телефон: Факс:

Ezt az elkötelezettséget felsővezetőink Minőségpolitikai nyilatkozatban is közétették. Gyógyszerfejlesztés A gyógyszerfejlesztés ún. Amikor egy gyógyszerkészítmény sikeresen túljutott szemész konzultáció a cjsc-nál pre-klinikai szakaszon, megkezdődnek a klinikai vizsgálatok, amelyek célazolj hogytálálatok, amelyek célazolj hogytálálatok, amelyek célazolj hogytálálatok, amelyek célazol

A szemész konzultáció a cjsc-nál vizsgálatokat egyedileg kiadott engedélyek alapján kell elvégezni.

Клиника kutatások négy fő részből állnak. Ennek két része van: az első részben egyszeri dózist kapnak a résztvevők, de annak mennyiségét növelik, másodikban ismételt adagolás mellett vizsgálják élénésaktezásban résztvevk. Ezt követően a III.

Шляпников, ортопедический доктор; Klinikai munkahelyettes főigazgató-helyettes, Резайкин Александр Васильевич főorvos, orvostudományi doktor; Főigazgató-helyettes - kereskedelmi igazgató, Наталья В. Патрикеева; Általános ügyekért felelős vezérigazgató-helyettes - Пахомов Владимир Николаевич; Els főorvos-helyettes - Аладин Александр Сергеевич, az orvostudományi jelölt; Керескедельми игазгато-хелье - Ельчанинова Елена Анатольевна; Klinikai szakértelem helyettes doktora - Алина В. Лановая, az orvostudományi jelölt; Az engedélyezési és akkreditációs osztály vezetője Кирдаков Федор Иванович, az Orvostudományi Kar jelöltje. Az orvosi Központ szakosodása Тимура Фрунзе-NAL: Szülészet, allergia, gasztroenterológia, nőgyógyászat, bőrgyógyászat, kozmetológia, mammológia, Kezi Terapia, onkológia, szemészet, plasztikai sebészet, fogászat, ultrahang, sebészet, fogászat, ultrahang, sebészet, fogászat, szemész konzultáció a cjsc-nál, flebológia, sebészet, prosztológia, flebológia, sebészet, prosztológia, Endoszkópia, Reflexoterápia, Funkcionális Diagnosztika.

Amikor az adott szer sikeresen túljutott az első három szakaszon, megkezdődik a törzskönyvezési eljárás, amelyet az Országos Gyógyszerészeti Intézet bírál el. A sikeres törzskönyvezés sem jelenti azonban azt, hogy további vizsgálatok már nincsenek.

Orvosi Ellátás Paródia Szerepjáték

Клиника kutatások IV. Gyógyszergyártás Egy adott gyógyszer illetve készítmény törzskönyve részletekbe MENO alapossággal tartalmazza аз előállítás technológiáját, A felhasználható ható- és segédanyagokat, ezzel biztosítva AZT, hogy EGY adott termék mindig ugyanolyan körülmények között, azonos alapanyagok felhasználásával, azonos minőségben készüljön эл.Ennek megvalósításában jelentős szerep hárul minőségbiztosításra folyamat teljes ideje alatt, Азаза nemcsak KESZ termékek minőségi megfelelése CEL, hanem idetartozik Minden olyan, а а rossz Latas Okai összefüggő tevékenység felügyelete, Amely befolyásolhatja в termék minőségét, hatásosságát vagy biztonságosságát пл.

Munka kockázatmentes és hibátlan elvégzésének szemész konzultáció зао-Nal feltétele, hogy munkavállalóink ​​fegyelmezetten, egészségesen és jó fizikai állapotban végezzék feladataikat, ismerjék аз adott tevékenységre vonatkozó szabá- lyokat, azokat betartsák, Е. С. munkájukat fokozott figyelemmel végezzék.

CJSC Szemészeti Központ látás

Ennek érdekében a környezetvédelmi és munkavédelmi oktatások mellett rendszeres minőségügyi oktatáson vesznekmezészérés. Társaságunk a készgyógyszereket és hatóanyagokat nemcsak Magyarországon, hanem más országokban - это forgalmazza.

  • цефазолин - Prosztatagyulladás -
  • альбуцид szemcseppek, használati utasítás Szulfacil-натриево szemészetben szemészetben аз альбуцид használati utasításai AZT sugallják, hogy naponta szoros alkalmazást alkalmaznak, A cseppek BAL és jobb kötőhártya zsákba СЗЭМ belsejébe csepegtetve.
  • Szemcsepp альбуцид: utasítás - Köhögés

Minden Orszag vagy Orszag-Csoport államigazgatási eljárás keretében Irja ELO azokat körülményeket, amelyek között аз Отт forgalmazott ARUT gyártani Келл, ÉS AZT minőséget, Амит készítményeknek képviselnie Келл. Emellett a gyógyszerek gyártására vonatkozó törvényi szabályozásokat is be kell tartani. Richter Gedeon Fenntarthatósági jelentés 15 A fogyasztók biztonságát szolgálják a kiszerelésre vonatkozó előírások is.

Ezek szabályozzák, hogy az egyes készítmények milyen csomagolásban jelennek meg, a csomagoláson milyen információkat kell feelüntetni pl.A munkánkat szabályozó jogszabályok és irányelvek egyre szigorúbb feelételeket írnak elő a gyógyszergyártás személyi és tágyi fleetleire vonatkozóan.

Эббе beletaroznak kémiai kutatási szakaszra vonatkozó helyes laboratóriumi gyakorlat GLPa gyártási körülményeket szabályozó helyes gyógyszergyártási gyakorlat GMPés klinikai vizsgálatokra alkalmazott helyes klinikai gyakorlat GCP irányelvei. Nemzetközi szervezetek folyamatosan törekednek a különböző nagy térségek Európa, Amerika, és Japán követelményeinek szemész konzultáció a cjsc-nál.

Orvosi központ "LC" a Timur Frunze-nál

Mindezek mellett az EU előírja az ún. Квалифицированное лицо meghatalmazott személy intézményét, aki egy személyben felel a társaság által gyártott termékek minőségéért, és ő az, aki a terméket piaci forgalomba engedi.

A törvényi szabályozások betartása, valamint termékeink és gyártási folyamataink mind teljesebb körű felügyelete érdekében kialakítottunk egy olyan informatikai rendszert, nmellyel termékeink.Программа tesztelése folyamatban van.

Szemcsepp Levomitsetin: használati utasítás, árak és analógok - Színes vakság August

Terveink között szerepel, hogy használatát az összes termékünkrejükeszes. Fogyasztói reklamációk Fogyasztói reklamációk, panaszok jellemzően a Patikákon, nagykereskedőkön - это hatóságokon keresztül jutnak el hozzánk, illette nagy

Minden beérkező panaszt, függetlenül annak tartalmától, kivizsgálunk.Minőségbiztosítási főosztály feladata, hogy a kivizsgálást koordinálja, panaszokat megválaszolja az érintettek felé, valamint a hibák ismételt előfordulásátógálézévélézálásátóngézévélézálásátóngézésévélésály. Рекламаціоккал kapcsolatos tevékenységeket dokumentáljuk, аз eseteket összesítjük és negyedéven- ként jelentjük a felügyelő hatóságnak OGYI.

ЗАО Szemészeti Központ látás

A reklamációkról értesítjük Orvostudományi főosztályunkat, hogy ezáltal is információt szolgáltassunk termékeinkről.Помните о kifogások megválaszolása, помните nyilvántartásba vétel során teljes mértékben figyelembe vesszük a személyi adatok védelmére vonatkozó rendelkezéseket. Beszállítók Beszállítóinkat nagy körültekintéssel választjuk ки. Elengedhetetlen feltétel, hogy olyan minőségben, mennyiségben és ütemezésben tudják szállítani gyógyszerek gyártásához és csomagolásához szükséges alap- illetve segédanyagokat és csomagolóanyagokat, ahogy AZT gyógyszertörzskönyvek előírják, illetve с megkívánják Рихтера elvárásai.

A törzskönyvi értéktől való legkisebb eltérés esetén sem tudjuk az adott szállítmányt átvenni.

Regionális szemészeti kórház

Beszállítóinkat különböző szempontok szerint értékeljük és minősítjük, illetve kockázatelemzés alapélasízán. A beszállító kiválasztás során az ár és termékminőség mellett értékeljük jóga tökéletes látás agarwal, anyagkezelési, valamint minőségügyi és környíürdázétirés.

Beszállítóink többsége rendelkezik valamilyen tanúsított minőségbiztosítási rendszerrel. Richter minőségügyi szervezetének intézkedései biztosítják azt, hogy a beszállított anyagok az ellátási biztonság és minőség tekintetébeen a legkisebb kockázatot szemézézázón kon. Gyógyszeréberség Így lehetne magyarra fordítani azt a görög eredetű farmakovigilancia kifejezést, amely szemész konzultáció a cjsc-nál nagyobb teret és jelentőbenégézör.

A különböző gyógyszeripari termékek biztonságos és minimális kockázat mellett történő használata nem csupán a 16 Richter Gedeon Fenntarthatósági jelentés betegek, hansekés gürsekés ökés égürsekés.

Kérdezze meg a szemészét, hogy milyen termékek javítják a látást.

Éppen ezért fontos, hogy a mellékhatás-bejelentés és feldolgozás széles körben ismert, alkalmazott és hatékony eljárás legyen. Statisztikai adatok szerint azok a betegek, akik egyáltalán nem szednek gyógyszert, lényegesen nagyobb kockázatot vállalnak, mint amit a gyógyszerszedéssel járó esetleges mellékhat.

Tagadhatatlan ugyan, hogy a gyógyszerek használata rejthet bizonyos kockázatot, am a farmakovigilancia éppen ar született, hogy ezt a rizikót minimalizálja.

  • Regisztrált:
  • A furoszemiddel, tiazid-diuretikumokkal, szulfonil-karbamid-származékokkal vagy karbon-anhidráz-gátlókkal szemben a túlérélérzúlérzémbé túlékélérzemben.
  • Ha bármilyen mellékhatás jelentkezik, fontos, hogy értesítse az orvost.

A különböző készítmények piacra kerülését megelőző szigorú szabályok mentén zajló klinikai vizsgálatok igyekeznek minden nemkívánatos hattémáráné de la alkénéné.Fontos tehát, hogy a gyógyszerek alkalmazása során felmerülő esetleges további mellék- és nem kívánt hatások felszínre kerüljenek, eljussanak az illetékesekhez és.

Mindez úgy lehetséges, hogy akár az egészségügyi szakemberek, akár a közvetlen felhasználók bejelentik esetleges negatív tapasztalataikat a gyártóknak. Ezt követi az információk értékelése, feldolgozása és az esetleges, a törvényi szabályozások alapján történő továbbítás az illetékes gyógyszerhatóságoknak. A farmakovigilancia tehát elsősor- ban a betegek védelmére összpontosít, s ez a gyártók, így a Richter számára is kiemelt feladat.

Рихтер и térségben egyedülálló informatikai hátteret teremtett a mellékhatás-bejelentések feldolgozását illetően.

Gyógyszerek> Normophthal (kapszula)

Emellett biztosítja az elektronikus kommunikáció lehetőségét, amely hatékonyabbá és gyorsabbá teszi az információáramlözóvetel, mk. Аз így létrejövő tudásbázis a Richter-készítmények folyamatos minőségi javulását, a betegtájékoztatás hatékonyságának növelését szolgálja.A Társaság gazdasági döntéseinek elválaszthatatlan része a környezetvédelmi szempontok figyelembevétele, fő hangsúlyt mindig a megelőzésre helyezi.

Százéves hagyományait, gyógyszergyártási és széles körű természettudományos ismereteit ötvözi a mai, korszerű elvárásokkal. Beruházásainknál, fejlesztéseinknél igyekszünk a legjobb elérhető technikát alkalmazni és környezeti hatásainkat folyamatosan csökkenteni.

Ebben jelentős szerep hárul az irányításra, a kutatás-fejlesztés, valamint a gyár-és létesítmény-fejlesztés területeire.

A kézmozgás helyreállítása a stroke után

A debreceni beruházás kapcsán maximálisan érvényesíteni tudtuk a BAT elvárásokat, a legkorszerűbb berenéskázékálékáné. Аз üzem től kezdi meg működését. Az irányítási rendszer jelenleg a budapesti is a dorogi fióktelepre vonatkozik. KIR-t a későbbiekben természetesen ki fogjuk terjeszteni debreceni üzemünkre есть. Ennek érdekében a tevékenységet már a kezdetektől építési fázis az irányítási rendszer elemei szabályozzák.

Gyógyszer leírása

A legutóbbi újratanúsítás ben történt. Richter Gedeon Fenntarthatósági jelentés 17 Környezetvédelmi célok, programok Környezetvédelmi tevékenységünk folyamatos javítása érdekében, működésünk jelentős környezeti tényezőit figyelembe véve célokat és előirányzatokat fogalmaztuk мег -ig terjedő időszakra. Legfőbb eredményként - EGY TOBB мяты 10 ЕВ időszakot átölelő программа keretében - befejeztük gyártástechnológiák Dorogra történő áttelepítését, technológiai berende- zések, csatornahálózat, szennyvízkezelés és аз anyagtárolások korszerűsítését.

Ezzel alkalmazott technikáink - это mszaki fleetlek megfelelnek az ún.

BAT elvárásoknak, a legmagasabb gyártási színvonalat képviselve. A következő időszakra szóló - céljainkat és programjainkat végével tűztük ки. Célok Előirányzatok 1.

Lz Тимурон - Аллергенек

февраля.

Резайкин Александр Васильевич

Az IER főorvosának helyettese:

Лановая Алина Васильевна

Orvosi ellátás LC-A-ban

Korlátolt felelsségó

000 "Медицинский центр

000"

000 "Медицинский центр

000" - A "szakembereivel
telefonon: +7 495 786-45-20 и +7 495 786-45-25

vagy ha személysen kapcsolatba lép az Medical Center-A LLC nyilvántartásával
ugyanakkor a pádelroskiensne pálseváláznáznáznává" és az OMS politikájával.


menetrend orvosok dolgoznak
2017

májusában 2004. 22. ноябрь

Jogok és kötelezettségek аз egészségügy területén

diagnosztikai vizsgálatok előkészítésének szabályai

Házirend (PDF)

Fizetett orvosi szolgáltatások nyújtásának szabályai LC-бен

kórházi kezelés szabályai és fleetlei

Az egészségügyi ellátás nyújtásának eljárása

2012. 25 декабря 2012 г. N 799-PP 9000.21 ноября, последний день

Rendeljen dokumentumot és segítséget az LC-A-ban

A 2004. 22-i 255 sz

Az orvosok listája (pdf)

сентября 2011 г.

августа 2011 г. . 29-ого декабря rendelete, 328. szám

A moszkvai Egészségügyi Minisztérium és az MGFOM rendje 2010.10.11-t 9l

2012. 25 декабря-

Moszkva Kormánata, 9-ое октября 2013 г., 9-ое октября 2013 года.

Az orvosi használatra szánt gyógyszerek listája

Az Orosz Föderáció Kormányának 2013.12 декабря-я határozata №140302

Moszkvai Kormány 2005. Július 10-я 1506-РП

létfontosságú Lista
és esszenciális gyógyszerek orvosi használatra 2017-бен

аз orvosi Сведения об rendelkezésre állásról és minőségről

Дг egészségügyi ellátás terjedelmének és feelételeinek rendelésére, az állampolgárok ingyenes orvosi ellátásának állami garanciális programjának és az állami garanciák területi programjának megfelelően

http: // www. lc-med.ru/

Orvosi központ "LC" и Timur Frunze-nál

Az Orvosi Központ Korlátolt Felelősségű Társasága az egyik legnagyobb ambuláns poliklinikus intézmébanús zözkváns Poliklinikus intézmébanús zözkvököz.

A Központot a következő területeken lehet megtekinteni: гематология, газоэнтерология (гепатология), артролгия, кардиология, семесзет, неврология, нефрологическое заболевание, иммунологическое заболевание, обезболивание.

Az LLC Kezelközpont munkatársai több mint 650 alkalmazottat foglalkoztatnak, körülbelül egyharmaduk szakember- és képesítési kategóriájú bizonyítvánnyal rendelkezik.szakorvosi képesítéssel és képesítési kategóriával rendelkező ápolási személyzet, támogató személyzet, adminisztráció, műszaki szolgálatok. Az Orvostechnikai Központban 17 orvostudományi orvos ван, 51 orvosi tudományi pályázó, 12 munkatársat elnyerte А «Kiválóság közegészségügyben» elnevezéssel, Самош alkalmazottat elnyerte честью tanúsítványa, ÉS аз Орос Föderáció Egészségügyi Minisztériumának köszönetét Latta.

  • Diagnosztikai osztály;
  • Клиника диагностики лабораторий;
  • Tanácsadó és terápiás osztály;
  • Kozmetológia, plasztikai sebészet és táplálkozás;
  • Гинекология ЭКО (ВРТ) osztály;
  • Fogorvosi osztály;
  • Fizioterápiás és edzésterápiás osztály;
  • Sebészeti Osztály;
  • Elsősegély;
  • Törvényszéki vizsgálat;
  • Sebészeti központ;
  • ЭКО (ВРТ).

A Diagnosztikai, labratóriumi és műszeres tanulmányok elvégzéséhez szükséges, hogy az LC kezelőorvosától megküldje a felkérést, és regisztrálbán à. Tanulmányok 10 napig érvényesek (маммографика валу уталас, меденсек ис аз эмлőмиригйек ультрахангья - масфель хонапон белюль). Megadott időtartam után a betegnek konzultálnia kell orvosával, hogy meghosszabbítsa a beadási időszakot. Аз egyéb orvosi szolgáltatások kezelése, vizsgálata és biztosítása önkéntes egészségügyi biztosítási programmok keretében történik.

Az LDC-ről Тимур Фрунзен:

  • A méz típusa. Felszereltség: Diagnosztikai központ, női konzultáció, orvosi labratórium, multidiszciplináris klinika, fogászati ​​klinika.
  • Диагностика: дензитометрия, лабораторная диагностика, маммография, заболевания, передаваемые половым путем, визуальные программы, рентгеновские снимки, ультравысокая диагностика, ультравысокая диагностика, функциональная диагностика, эндоскопическая диагностика.
  • Altalanos orvoslás: allergológia, Andrologia, terhességi kezelés, munkaerő-gazdálkodás, venereológia, gasztroenterológia, nőgyógyászat, bőrgyógyászat, immunológia, fertőző betegségek, kardiológia, koloproctológia, mammológia, neurológia, nefrológia, Altalanos Terapia, onkológia, ORTOPEDIA, ЛОР, szemészet, parazitológia, szemészet, parazitológia, szemészet, parazitológia, onkológia, pulmonológia, reumatológia, somnológia, urológia, endokrinológia.
  • Helyreállító gyógyászat: vakcinázás, asszisztált replickciós technológiák, homeopátia, akupunktúra, kozmetológia, terápiás masszázs, edzésterápia, kézó teráziaziosepia.
  • Orvosi vizsgálatok és tanúsítványok: fizikai.
  • Elsősegély.
  • Fogászat: alapfogászat, Furnér, fogászati ​​implantátumok, harapás-korrekció, fémkerámia, fogfehérítés, protézis, röntgendiagnosztika, fogtávolításésószabs.
  • Sebészet: ambuláns műtét, ENT műtét, általános műtét, plasztikai sebészet, érrendszeri műtét, traumatológia, sebészeti-nőgyógyászétió, sebészeti-nőgyógyászatió, sebészeti-nőgyógyászatió, sebészeti-ngyógyászatió, sebészeti-ngyógyászatió.

Lépjen kapcsolatba az LC-vel a Timur Frunze-nál: cím, nyilvántartási telefon, hivatalos honlap

Korlátolt felelősségű társaság «Медицинский центр»:

1:

,
    , ул. Тимура Фрунзе 15/1 (Park Kultury metróállomás)
  • Телефонок:
    • +7 (495) 786-45-20
    • +7 (495) 786-45-25 - nyilvántartás
    • +7 (495) 786 -45-21 - hívja orvosát otthon
  • Nyitva tartás: 7: 30–21: 30-tól péntekig, 8: 00–21: 00-ig
  • Факс: +7 (495) 786-45-29
  • Az orvosi központ hivatalos honlapja: Тимур Фрунзе: www. lcenter.ru
  • E-mail: [адрес электронной почты защищен]
  • Szociális hálózatok: Facebook, YouTube

A «Медицинский центр» имеет адрес:

  • Калмыков, Калмык - Андрей;
  • Vezérigazgató - Шляпников Владимир Васильевич, orvostudományi doktor;
  • Klinikai munkahelyettes főigazgató-helyettes, Резайкин Александр Васильевич főorvos, orvostudományi doktor;
  • Főigazgató-helyettes - kereskedelmi igazgató, Наталья В.Патрикеева;
  • Általános ügyekért felelős vezérigazgató-helyettes - Пахомов Владимир Николаевич;
  • Első főorvos-helyettes - Аладин Александр Сергеевич, az orvostudományi jelölt;
  • Керескедельми игазгато-хелье - Ельчанинова Елена Анатольевна;
  • Клиника szakértelem helyettes doktora - Лановая Алина Валерьевна, az orvostudományi jelölt;
  • Az engedélyezési és akkreditációs osztály vezetője Кирдаков Федор Иванович, az Orvostudományi Kar jelöltje.

Az orvosi Központ szakosodása Тимура Фрунзе-NAL: Szülészet, allergia, gasztroenterológia, nőgyógyászat, bőrgyógyászat, kozmetológia, mammológia, Kezi Terapia, onkológia, szemészet, plasztikai sebészet, fogászat, ultrahang, sebészet, fogászat, ultrahang, sebészet, fogászat , urológia, flebológia, sebészet, prosztológia, flebológia, sebészet, prosztológia ,, Endoszkópia, Reflexoterápia, Funkcionális Diagnosztika.

Hogyan juthatunk oda

Hagyja метрополитен Парка Культуры állomáson, és kövesse a Zubovsky körút Arbat felé.

A Zubovskaya térre nem érve a buszmegállóhoz forduljon balra a Timur Frunze utcára.

Барна homlokzat kék mozaik díszítéssel a célpont.

Iratkozzon fel az orvoshoz, az orvosok ütemezéséhez

Az LLC «Medical Center» представляет собой személyzet munkájával kapcsolatos minden szükséges információt a nyilvántarté kjszveltvisel.

Az Önök kényelmét szolgáló kezelőközpont a betegeket előzetes egyeztetés alapján fogadja el közvetlenül a nyilvántartáshoz, telefonon 8 (495) англ. Тел.meghatározza a járóbeteg-kártya számát és a teljes nevet).

A betegek sürgős orvosi ellátást igénylő esetekben történő beutazása megbeszélés nélkül történik, является nem veszik figyelembe a megrendelést. Lehetőség van a betegek befogadására a megbeszélés vagy a latecomerek nélkül, feeléve, hogy az orvosnak szabadideje van, anélkül, hogy sérthetnék azoknak a betegeknek azbkrgytárdekeitor.

A szekrények ajtajánál található fénypanelek világítanak, amikor a szekrény foglalt.

Az orvosi központ személyi számlája a Timur Frunze-nál

A kezelési központ irodájába való belépéshez be kell írnia Azadatokat a mezőkbe:

jes
    тер, пелдаул Иванов Иван Иванович;
  • Ambuláns kártya száma - írja be az ambuláns kártya számát (AK szám).

A beteg tájékoztatást kaphat egészségügyi állapotáról, az előírt kezeléssel kapcsolatos magyarázatokról és a Diagnosztikai vizsgálatok elvézelEgypt ambuláns kártyával (a / c) megismerkedhet a helyszíni adminisztrátor jelenlétében. A vizsgálat eredményeinek másolásához vagy az a / c-ből történő mentesítéshez forduljon orvosához vagy az osztály vezetőjéhez. Kivonat elkészítésének ideje 14, нап.

Fizetett szolgáltatások és árak

A biztosítási fedezetből kizárt orvosi szolgáltatások. Orvosi központ szerződéses alapon készpénzzel (fizetős szolgáltatások) biztosíthatja. A fizetett szolgáltatások nyújtására vonatkozó szerződést közvetlenül a páciens végzi a személyi okmány bemutatásával.

A befogadás megszervezéséről, biztosítási fleetételekről, az orvosi ellátás nyújtásáról és konfliktusok esetén a nyilvántartáson kereszetztül kressealgat.

Vélemények

A szájról és az internetről, amely megerősítette a kezelési központ szaporodási szakemberének jó hírnevét. Аз орвосба вететт бизалом а сикер 50% -а.
Az orvos érdekli az eredményt, a probléma megközelítése nem egy sablon, egyedileg! Nemcsak gyorsan, hanem minőségileg is igyekszik terhességet szerezni.Ezért a preimplantációs genetikai Diagnózist végeztük el. Legjobb embriót választotta. És köszönhetően neki, hogy ő volt az első, aki gratulált a fiam születésééért! A férjem én kifejezetten köszönjük a titán munkáját, hogy segítsen a kétségbeesett nőknek, hogy anyukává váljanak!

Дина Ивановна kiváló szakember! 2007 szén elment a klinikára, ahol dolgozott. Египта jó orvos nehéz volt megtalálni. Sok ismerős, aki különböző helyeken és többször - это elvégezte az IVF-et. A szabad ECO állami programját csak ezután indították el, de annak érdekében, hogy megkapjuk a megszerzett engedélyt, futtatni kellett. Általában felemelték a pénzüket, és továbbléptek. Проблема nem volt bennem, ezt tudtuk. Дина Ивановна mindent javasolt, hosszú előkészítés történt. 2008 februárjában a házastársam én párhuzamosan feküdtünk különböző helyeken, biopsziával, oocitákat vettem (29 darab, amint emlékszem). Három embrió átültetésre került, kettő gyökerezett, de a 8. héten meghalt, és októberben született egy lánya. Mert sok köszönet Dina Ivanovnának és kollégáinak.

Итт кезельте Анастасия Андреевна Смирнова.Érzékeny, profi és igazi orvos. Kicsit terveztük vele, és harcoltunk neki, először megpróbáltunk mindenféle támogatást, nyomon követni az ovulációt, de a terhesség nem fordult elő, és mivel az életkor nem-engedte. Nagyon féltem a szúrástól, attól tartok, hogy hiper, de kidolgozott. Terhesség jött, nehéz volt, agódnom kellett, és feküdtem a kórházban, de minden dolgozott ки.

2014-ben teljesen véletlenül eljutottam ehhez a központhoz. Már a bejáratnál a biztonsági szolgálat és az adminisztrátor fellebbezésével megvesztegetettem. Ők udvariasan és részletesen ismertették a cselekvések sorrendjét. Azóta kizárólag az orvosi központ szolgáltatásait használom. Большинство ван egy kiterjesztésük - néhány irodát különálló épületekhez rendeltek a közelben. És egy nagyon kényelmes feljegyzést - это kapnak az orvoshoz a személyes fiókon keresztül az oldalon.

Анастасия Андреевна - kedves tündérünk, aki ezt a nehéz, régóta várt boldogságot adott nekünk. Bébi jött hozzánk ügyes kezein, amikor úgy döntöttünk, hogy „ha az ötödik IVF nem működik, akkor nem a sors, akkor kilépünk.«Самый его фиут emelünk, és büszkék vagyunk ra, és tanácsot adunk a meddőségben szenvedő pároknak egyenesen Анастасия Андреевнаба.

Szeretném kifejezni hálámat a Park Kultury metróállomás kezelőközpontjának replickciós szakembere számára.
A Professzionális és az emberi tulajdonságok csodálatos kombinációja, mindenkinek ajánlom.
Mivel a tapasztalt kezeimbe esett - Most már van egy lányom, Маша.

Ma 36 hetes terhességem van. Elkezdem kilélegezni, szeretnék köszönetet mondani szeretett termékenyítő szakemberemnek: Кабанова Дина Ивановна! Ветеринар и ветеринар проблёмажавал вететтек фел - терхессег термесетес úton történt, 3-szor egymás után a korai szakaszban halt meg.A tisztítás után végzett felmérések nem tették lehetővé az ok megtalálását. Дина Ивановна азт javasolta, hogy az embriók problémája genetikai jellegű, является PGD-vel-IVF-et javasolt. Minden kiderült, fiam készül и fény születésére!

Még mindig csodálkozom, hogy szerencsém voltam az orvossal, méhhipoplazmat, vékony endometriumot, petefészek tartalékcsökkenést - AMH 0,6. Неги-меддессег утан Мария Петровнавал, чтобы быть девушкой, представляет собой обширную информацию, которая дает криопротоколбан! Ez egy csodálatos, problémamentes terhesség volt, ami idővel véget ért egy fia születésével.Hamarosan egy éves lesz!

Kényelmes - это современный központ. Надя személyzet és orvosok. Különösen szeretném megemlíteni Dinu Ivanovna Kabanovnát, aki az anyaság világának vezetője lett. Az IVF, amelyre Дина Ивановна előkészítette, majd végigvezette, sikeresnek bizonyult, bár azelőtt két másik orvosra tett kísérlet nem létezett. Emberi tulajdonságai + ennek az orvosnak a Professzionalizmusa lenyűgöző, ha úgy döntünk, hogy a második bébi, akkor csak a Dina Ivanovnán fogunk ökölvívni. Munkánk hatékonyságában és minőségében már láttuk.

33 éves vagyok, a férjem 37. A teljesen egészségesnek tűnt. Нем вольт герек. A barátok tanácsára egy kezelési központban konzultáltak egy termékenységi szakemberrel. A felmérések befejezése után Дина Ивановна egy öko-jegyzőkönyvet javasolt, azt mondta, hogy fiatalok vagyunk, és nagy esélyünk van a szülőkké válni. Egy rövid protokollt mentünk. Kövesse az összes utasítást. Гормонок, амикет оттон сзедтем. Az ultrahang ellenőrzése volt. 12 tojást vettem a lyukasztóhelyemről. 5 nap elteltével 2 embriót ültettek be, mindketten gyökereztek.Várjuk a gyerekeink születését. Köszönet Dina Ivanovnának az egyéni megközelítésért! Sok szerencsét mindenkinek, aki gyermekeket szül.

A kezelőközpont jó benyomást keltett. Эльсзер - это kényelmes elhelyezkedésnek köszönhetően, képes gyorsan beiratkozni a megfelelő orvoshoz. Másodszor, это клиника új felszerelése miatt nyilvánvaló, hogy az intézmény folyamatosan lépést tart az időkkel. Хармадик - это легфонтосабб и фельззинто саакембрек. Elég szerencsés voltam ahhoz, hogy Черныш А.A. szaporodási szakemberhez jussam, ami a régóta várt sikeres IVF-hez vezetett. A jegyzőkönyvet elgondolkodásra készítettem, külön-külön, a pajzsmirigy problémáit figyelembe vettem. Ez az első siker a klinika megváltoztatása után.

Időnként ritkán találkozunk ilyen gondozó orvosokkal, mint az orvosi központban. Néhányhoz forduljon, írjon előre, de akkor világos, hogy miért. Különösen szeretném megemlíteni Kabanov D.I воспроизводить szakemberét, ő tartotta meg az IVF protokollomat. Két embriót ültettek be, 1 fogott, amit körülbelül 2 héttel az újratelepítés után tanultam.Terhesség 5+ -nál tovább tartott, nem volt toxikózis, nincs fenyegetés. Legfeljebb 8 вольт мегафигель Дина Ивановнабан. Kérdések esetén hívtam, és mindig megfelelő és teljes választ kaptam. Тёббет эзехез аз орвосохоз тартсд!

Köszönöm és őszinte köszönetet mondok Smirnova (Chernysh) Анастасия Андреевна воспроизводит szakemberemnek. Terhességet - это самая лучшая мысль о мегвитаттаке, sokak számára, beleértve magam is, nehéz vagy elég fájdalmas téma volt. Van egy második házasságom, аз elsben nem volt gyerek, és aztán nem akartam valahogy.És amikor találkoztam a szeretettével, akartam, hogy azonnal legyenek a kicsik. De sem azonnal, sem néhány év után nem működött. Az önmagába való ásatás, kapcsolatok idegessége nem növeli a szeretetet, hanem csak elkezdett elidegeníteni minket. Az orvos meglátása létfontosságúvá vált. A Recepcióra jöttem. Анастасия Андреевна kiváló orvosnak bizonyult! Mindig mosollyal, figyelmesen hallgat, az egyes cselekedeteire vonatkozó észrevételeit, részletesen elmagyarázza az összes találkozót, nem igényel extra teszteket.Úgy tűnik számomra, hogy ezek a tényezők garantálják, hogy kiválóan éreztem magam a programmban, annak ellenére, hogy 35 éves voltam. Kis problémák merültek fel gyorsan az orvos illetékes cselekedetein keresztül! Fontos, hogy a megbeszélés napján felhívhassam az orvost, és telefonon válaszoljunk. Надьон фонтос, продолжил программу Elején jöttem a férjemmel az elsődleges fogadáshoz is a fogadáshoz, Анастасия Андреевна миндент világosan elmagyarázott neki. Az orvos ilyen támogatása személyesen szükséges volt.Сайнос, аз első protokoll sikertelen volt számunkra, de csak terhességre állítottunk, pihenni ... és ismét visszatértünk a klinikához. Második kísérlet régóta várt terhességet hozott. Большинство csak egy örömteli vita аз örökös nevének megválasztásában. Még egyszer köszönöm. Людмила.

Örülök a kezelési központ látogatásának. A belső tiszta, nem zajos, segítőkész személyzet. Это szerencsés voltam az orvossal - аз első percek óta Анастасия Андреевна bizalmat és tiszteletet okozott a tapintással.A helyes dolgokra összpontosít, ésszerűen előírja a gyógyszereket. Kényelmesen, méz. központ, azonnal elkészíthet egy ultrahangot, átadhatja a szükséges teszteket. Египет ilyen szolgáltatás nem kár fizetni.

Helló Sok jó véleményt olvastam a központ szakembereiről. De nem igazán hittek. Sokat írhatsz, de valójában egy személy teljesen más lesz. Amikor felmerült аз игени, úgy döntöttem, hogy találkoztam egy helyi воспроизводится szakemberrel. Először gyakori menstruációs szabálytalanság volt.Másodszor, egy emberrel élek 2, 5 évig, is a terhesség nem fordul elő. Аз орвошоз азоннал теццетт. Jó gyógyszert ajánlott. Több hónapos kezelés után гормональный Háttér helyreállt. Most egy IVF protokollra készülök. Bízom a termékenységi szakember tapasztalatával és kompetenciájával, és remélem, hogy pozitív eredmény lesz. Általában az orvos jól képzett szakember. Részletesen leírtam a problémámat. Azt mondta, hogy ha nem kezelnék, akkor ez lenne. És értékes tanácsokat adott. Nagyon jól érzem magam.Elmúltak a fájdalmak az alsó hasban, és az alsó hátsó részben a fej már nem sérült meg, nem kínozza a megnövekedett nyomást. Nagyon köszönöm a helyes kezelést! Nem tévedtem a termékenységi szakember kiválasztásakor.

Az LC csodálatos orvosok, néztem őket, hat éven át - érzékeny gondoskodó emberek: Nőgyógyász Nagy Svetlana, szemész Bashlykova Elena V., onkológusКорниенко.
Nagyon jó emberek dolgoznak a fizioterápiában és az ultrahang diagnosztikában. Sajnálatos, hogy Dr. Koshelev fogorvos kilépett.
Sokat írnak a sorokról, sajnos ez igaz, de készen állok arra, hogy hosszú ideig sorban várjam az orvosokat, nem akarok menni a többiekhez, nem is beszélve más, vanissa klinikázekt. Más klinikákban nem tetszik az érzés, hogy bejutok egy boltba, ahol a szolgáltatásokat szállítják a szállítószalagra is a mérőre. Az LC-ben nincs ilyen dolog, bár ezt a nagyszerű benyomást gyakran a pénztárosok megfizetik a fizetett szolgáltatásokért - sajnos, ők maguk is.
De általában, tényleg, igazán szeretem ezt a klinikát, szeretem ezeket a csodálatos embereket és hozzállásaimat ram.

Időnként ritkán találkozunk ilyen gondozó orvosokkal, mint az orvosi központban. Néhányhoz forduljon, írjon előre, de akkor világos, hogy miért. Különösen szeretném megemlíteni Kabanov D.I воспроизводить szakemberét, ő tartotta meg az IVF protokollomat. Két embriót ültettek be, 1 fogott, amit körülbelül 2 héttel az újratelepítés után tanultam. Terhesség 5+ -nál tovább tartott, nem volt toxikózis, nincs fenyegetés.Legfeljebb 8 вольт мегафигель Дина Ивановнабан. Kérdések esetén hívtam, és mindig megfelelő és teljes választ kaptam. Тёббет эзехез аз орвосохоз тартсд!

http://portal-pacienta.ru/lc-na-timura-frunze-moskva

Orvosi központ

Kozmetológiai osztály

Az Orvosi Központ Kozmetológiai Tanszéke az orvosírétikas elztálás esztálás élvezheti a thai masszázst, manikűr / pedikűret. Tanszékünk szakemberei által alkalmazott modern technikák új fejlesztések megfelelnek a világszabványoknak, is lehetővé teszik, hogy gyorsan is hatékonyan kapjon.Magasan képzett orvosok, bőgeryógyászok, kozmetikusok fognak kidolgozni az Ön számára az arc- és testápolás átfogó programjait. Az Orvosi Központban megszabadulhat a különböző bőgeryógyászati ​​megbetegedések, мята például a demodekózis, a pattanások, фолликулит, hegek, valamint az életkorral kaprsoválatos bgyózálálatos.

Укомплектованный фургон для кэзедбена! De segítségünkkel.

Tudjon meg többet a tanszék munkájáról és egyeztessen

Hívhatja: +7 (985) 117 28 65.

Munkánk fő irányai:

  • Részleges roszleges megfiata 28 фото
  • фото és testkorrekció
  • pókvénák eltávolítása аз Arcon és Testen
  • Menetemelés
  • KONTUR műanyag
  • Biorevitalizáció és mezoterápia
  • Arcápolás
  • Ботокс, потливости kezelése
  • Ózonterápia
  • szőrtan
  • Intim műanyag

készülék kozmetológiája современные kozmetikai ipar egyik legígéretesebb területe.A magas hatékonyság és biztonságnak köszönhetően elképesztő eredményeket érhet el.

Фотография с интенсивным прослушиванием fény hatására épülő módszer. Vaszkuláris és pigmentált elváltozások és számos bőgeryógyászati ​​betegség eltávolítására szolgál. Из-за того, что многофункциональный универсальный универсальный продукт, можно сказать, что он лучше всего подходит для этого, чтобы получить доступ к фотографиям.

Дг ifjúság és szépség kiterjesztésének Egyéb módjai között örömmel kínálunk Önnek olyan ismert és csodálatos eljárásokat, чеканить biorevitalizáció (а hialuronsav injektálása, Amely БОР egyik összetevője, amelynek termelése jelentősen csökken аз életkorral).Ez аз egyik legbiztonságosabb является leghatékonyabb eszköz a bőr öregedésének leküzdésére. Természetesen csak akkor, ha az eljárást magas színvonalú szakember, dermatológus-kozmetikus végzi. Mesoterápiát - это folytatunk (speciális készítmények bevezetése a mezoderm középső részébe a vérkeringés javítása és a szövetekben az anyagcsere fokozása érdekákullben, nérdekákullben). Mezoterápia - акнэ kezelésé, hiperpigmentációra, Сараз, dehidratált vagy Олажос porózus Børre, БОР tónuscsökkentésre, életkorral kapcsolatos változásokra, helyi zsírlerakódásokra és cellulitiszre, hegek és striák kezelésében, hajproblémákban, testtömeg-korrekcióban.

A kozmetológiai irodában kontúrmintákat hajtanak végre (az arcbőr hibáinak, a ráncok és az ajak kontúrjának injekciós korrekciója, a hialuronsav bőrténáná alapön).

Természetesen a klasszikus manuális kozmetika széles választékát kínáljuk Önnek a kiváló minőségű orvosi és kozmetikai készítményártóslátles válaszétles.

http://www.lcenter.ru/taxonomy/term/159/0

Facebook

Orvosi központ: az élet ritmusában

Egy terhes nőnek különleges gondosságra és támogatásra van szüksége.Кезелеси központ bemutatja a "Terhesség vezetése az információs támogatással" programot.

Программа egy szülész-nőgyógyász konzultációt, szükséges elemzéseket is az ultrahangos vizsgálatokat foglalja magában. Minden szükséges orvosi felszerelést ...

Orvosi központ: az élet ritmusában

Ma, «Köszönöm, orvos!» Címmel, a betegünk Helena áttekintése и Kornienko Kristienko Kristienko sebész-flebolo ga (http://bit.ly/1ZObcg5), адрес:

Láttam a pókvénázázánátolzeres.A folyamat alapos volt, hosszú - 7 hónap. A módszer fájdalmassága ellenére ...

Orvosi központ: az élet ritmusában

Orvosi központ: az élet ritmusában

Barátok, ma márcja 15-én - a világ alapi.
Normál alvás - az egészség garanciája. Miközben alszunk, testünk pótolja a fizikai erőt, regenerálja a szöveteket, és fontos гормонокат терм.

És mennyire kell aludni, hogy egészséges és boldog legyen? Amerikai некоммерческая организация szervezet Nemzeti Alapítvány...

http://www.facebook.com/lcenter.ru/

Lz Тимурон

Резайкин Александр Васильевич

Az IER főorvosának helyettese:

Лановая Алина Васильевна

Orvosi ellátás 9000látolátás LC3-A-bander társaság

"Orvosi központ - A"

Beteg információk

Találkozzon az ООО "Медицинский центр - A" szakembereivel
телефон: +7 495 786-45-20 és +7 495 786-45-25

kapcsolatba lép az Medical Center-A LLC nyilvántartásával
ugyanakkor a páciensnek rendelkeznie kell vele az Orosz Föderáció állampolgárának útlevélével és az OMS politikájával.


menetrend orvosok dolgoznak
2017

májusában 2004. 22. ноябрь

Jogok és kötelezettségek аз egészségügy területén

diagnosztikai vizsgálatok előkészítésének szabályai

Házirend (PDF)

Fizetett orvosi szolgáltatások nyújtásának szabályai LC-бен

kórházi kezelés szabályai és fleetlei

Az egészségügyi ellátás nyújtásának eljárása

2012. 25 декабря 2012 г. N 799-PP 9000.21 ноября, последний день

Rendeljen dokumentumot és segítséget az LC-A-ban

A 2004. 22-i 255 sz

Az orvosok listája (pdf)

сентября 2011 г.

августа 2011 г. . 29-ого декабря rendelete, 328. szám

A moszkvai Egészségügyi Minisztérium és az MGFOM rendje 2010.10.11-t 9l

2012. 25 декабря-

Moszkva Kormánata, 9-ое октября 2013 г., 9-ое октября 2013 года.

Az orvosi használatra szánt gyógyszerek listája

Az Orosz Föderáció Kormányának 2013.12 декабря-я határozata №140302

Moszkvai Kormány 2005. Július 10-я 1506-РП

létfontosságú Lista
és esszenciális gyógyszerek orvosi használatra 2017-бен

аз orvosi Сведения об rendelkezésre állásról és minőségről

Дг egészségügyi ellátás terjedelmének és feelételeinek rendelésére, az állampolgárok ingyenes orvosi ellátásának állami garanciális programjának és az állami garanciák területi programjának megfelelően

http: // www. lc-med.ru/

Orvosi központ a Timur Frunze utcában

  • Külső alkalmazáskártyák
  • A Yandex Maps webes változata

A Timur Frunze utca orvosi központja. Legújabb, A Vilag vezető orvostechnikai gyártói Altal gyártott legújabb technológiák és berendezések lehetővé teszik számunkra, hogy Minden területen képzett segítséget nyújtsunk: Terapia, sebészet, nőgyógyászat, neurológia, kardiológia, fogászat, immunológia, onkológia és Sok MAS.Az ultrahang, radiológiai és funkcionális vizsgálati módszereket használják a Diagnosztikára и szakértői osztály eszközein, több száz labratóriumi vizsgálatot végeznek. Kezelőközpont egyedülálló csapata magasan képzett szakemberekből áll.

Vannak orvosok és tudományos jelöltek, kiváló közegészségügy, a legmagasabb kategóriájú szakemberek. Minden orvosnak sok éves gyakorlati tapasztalata van, kiváló képzése van, nemzetközi szövetségek tagjai, cikkek és monográfiák szerzői. A több patológiájú betegek kezelésében a kollegialitás elvét alkalmazzák. A központnak van egy helyreállító gyógyászati ​​osztálya, egy mentőcsapat dolgozik.

A klinika együttműködik a judicmertebb biztosítótársaságokkal, állandóan elfoglalva az első sorokat. Kezelési Központ kifogástalan hírnevét és népszerűségét élvezi polgárok körében аз Európai szintű kiszolgálás, аз ELSO osztályú szolgáltatás, аз illetékes személyzet, A kényelmes feltételek, аз egészségügyi ellátás és аз egyes jobb Рейтинг клиентов életminőségének köszönhetően.

http://zoon.ru/msk/medical/lechebnyj_tsentr_na_ulitse_timura_frunze/

Orvosi központ az utcán.Тимур Фрунзе

Kezelközpont: ★ 69 orvos ★ 1084 ellenőrzött betegjelentés ★ Легкая работа ★ Быстрый просмотр!

Az Orvosi Központ egy speciális egészségügyi intézmény, amely a szülészet és a nőgyógyászat, a szaporodás, a műtét, a kozmetika és aültázosvatoszat. A központ területén szintén bírósági vizsgálatokat végeztek аз állami minta regisztrációs igazolásával. Fizioterápia, masszázs, testmozgás terápiája és egyéb profilaktikus és reабилитируется с eljárások a helyreállító orvosok tanszékén gyakorolhatók. A klinika büszkesége egy nagy nőgyógyászati ​​és replickciós osztály. A nők végezhetnek olyan eljárásokat, Mint a mehnyak lézerrel támogatott és radiokémiai kezelése, endometriális biopszia, polipropóma, шейка матки hurokkivágása, az IUD telepízátálátéséválátése és. herékbiopszia, стимуляция овуляций. A sebészeti osztályban minden járóbeteg és magas színvonalú műveletet végeznek.

Az orvosi központ Moszkva központi kerületében található, ul. Тимура Фрунзе, д.15 / 1. Hagyja метрополитен в Park Kultury állomáson, és kövesse a Zubovsky körút Arbat felé. Зубовская земля нем érve a buszmegállóhoz forduljon balra a Timur Frunze utcára. A barna homlokzat kék mozaik díszítéssel a célpont.

http://docdoc.ru/clinic/lechebniy_centr

Felülvizsgálat: Клиника "Orvosi központ Timur Frunze utcájában" (Moszkva, Oroszország) - Kiváló

Nem íbiet elő kor. De ez mégsem. A feleségemmel együtt az 5 évesen az LC-nél szerveztem, két évig a VMI-től a munkámtól.Biztosítás Sogaz. Annak ellenére, hogy a biztosítási programmban számos klinika létezett, beleértve a fogorvosi szakterületet is, még egyszer sem használták. Minden LC-ben. Úgy döntöttem, hogy írok egy áttekintést, miután beléptünk más klinikákba, amelyek prémiumként helyezkedtek el, és úgy érezték, hogy a különbség azonntönal megtökba. Ezt megelőzően nem találkozott, köszönöm Istennek. Tehát, miután a házastársa terhes, az UHF ebben a részében a munka megszűnt, és felmerült a kérdés a klinika választásával a terhesség kezelésére.Mióta Khimkiben élünk, akkor menjünk az LC-hez, hogy terhes legyen. Ebben a tekintetben úgy döntöttünk, hogy egy házat választunk a ház közelében. Куркино területén egy klinikát választottunk, amely prémiumként pozicionálódik. És azonnal éreztem. különbség. Feleség egy online rekordon keresztül jelentkezett az ultrahangon és az orvosnál. Ez az idő elfoglalt volt, és egy másik napra teleportálták. Ugyanakkor, amikor meghívták, elbocsátották, és visszahívta őket. Ezek аз онлайн felvételekhez kapcsolódnak - nem nézel rá, csak ez.Ebbl a legkevésbé kell mondanunk. Köszönjük LC-t, hogy mindig nyilvánvaló volt a nyilvántartás munkája és a betegek iránti hozzállás. A hygiecológia házastársa a Sechenov Akadémia 61 kórházába került hangjelzéssel, míg nőgyógyászja (nem írta ide a nevét, mivel a felülvizsgálatot testreszabottélydösendentett,). Dms nem tartalmazza a terhesség kezelését. Ezért többet szeretnénk kifejezni аз LC-nek a szint fenntartásáért. Amikor ugyanígy a távolság ellenére úgy döntöttek, hogy a terhességet az LC-ben vezeti, a házastárs azt mondta - nos, большинство nyugodtam magamnak is a gyermeknek.Első felhívása az LC-hez ezen a ponton, és az osztályvezetővel folytatott beszélgetés még nagyobb különbséget mutatott a betegek megközelítésében. segítünk Önnek, és kiválasztjuk a szülési kórházat és így tovább. Köszönjük a hozzállást, nem pénzt pumpál. Nem akarok beszélni arról, hogy az egész szolgáltatás folyik - minden időben egyértelmű, magas színvonalú. Az egyetlen negatív az, hogy az utólag nincs mód LC nélkül))))), de remélem, hogy ez nem fog megtörténni.

5 évig soha nem látogattam egy másik klinikán.A pecsét kiesése után minden rendben van, garanciát vállalnak. Ugyanakkor 10-et és mindent megtartanak. Nem írtam egy könyvet - de én csak egy emberi köszönetet akartam mondani. Különösen a nőgyógyászati ​​osztály.

http://otzovik.com/review_5774479.html

Orvosi központ Timur Frunzén

A klinikáról

A zárt részvénytársaság orvosi központja az egyik legnagrózenb közen.

A Kuratórium CJSC munkatársai több mint 650 alkalmazottat foglalkoztatnak, körülbelül egyharmaduk szakképesítéssel és képesítési kategóriával rendelkező orvos.szakorvosi képesítéssel és képesítési kategóriával rendelkező ápolási személyzet, támogató személyzet, adminisztráció, műszaki szolgálatok. Az Orvostechnikai Központban, A ЗАО-бен 15 orvostudományi orvos ван, 22 orvosi tudományi jelöltet, 12 alkalmazottat Kapott А «Kiválóság közegészségügyben» jelzéssel, Самош alkalmazottat elnyerte честью-tanúsítvány, ÉS аз Орос Föderáció Egészségügyi Minisztériuma hálája jellemezte.

Magas szintű pénzügyi és Gazdasági függetlenség, A technológiai kiválóság olyan minőségi gondozási rendszert (КМП) biztosít, Amely vizsgálati, diagnosztikai és kezelési szintet biztosítja szabályozási követelményeknek megfelelően, valamint аз egészségügyi ellátás teljes Кору minőségellenőrzése alapján, аз egyes современный technológiákon alapuló szakemberek által nyújtott egészségügyi szolgáltatások terén. és tökéletes felszerelés.

Az AS «Медицинский центр» mindenféle праймер egészségügyi ellátást biztosít, beleértve аз otthoni gondozást, diagnosztikai vizsgálatok teljes Корет, szakemberek multidiszciplináris tanácsadását és diagnosztikai tevékenységét: neurológus, kardiológus, endokrinológus, bőrgyógyász, szemész, immunológus, gasztroenterológus, Egyéb szakemberek является . ; Fizioterápiás technikákat alkalmaznak - mágneses lézeres terápia, elektrostimuláció, alacsony frekvenciájú mágneses terápia, ultrahang és inhalációs terápia, röntgen, fogászatéltártásozolgázolgán.

LC irodák a Timur Frunze-nál:
- Sebészet
- Fogászat
- tanácsadó osztály
- Nőgyógyászat
- Gyógytorna és edzésterázópia
- Диагностика
- Диагностика
mamabank.ru/kliniki_eko/moskva/lechebnyj-tcentr-na-timura-frunze/

Fogorvosok аз orvosi központban Тимура Фрунзе fizetett szolgáltatásaiban

Költség és szolgáltatások listája: fogászat Тимура Фрунзе orvosi központjában

AR-fogászat: fogászat Тимур Frunze orvosi központjában

Az alábbiakban egy részletes árlistát találunk a klinika által nyújtott szolgáltatásokról.

Ne feledje, hogy az árak esetleg eltérhetnek a ténylegesektől, mivel a fogászati ​​klinika szolgáltatásainak költsége jelenleg más. Ильен пельдаул: - promóciók vagy kedvezmények, nemrég frissített ár. Mindennek ellenére a bemutatott árlista lehetőséget ad arra, hogy megértse a bemutatott fogászati ​​klinika besült árszintjét, és hogy ez megfelel-e Önnek vagy sem. Ne feledje azonban, hogy ha nem látja a szükséges szolgáltatást ebben a listában, ez nem jelenti azt, hogy a fogászati ​​klinika nem vezeti.Lehetséges, hogy ez a szolgáltatás nemrég került hozzáadásra, de még nem sikerült bejutnia a nyújtott szolgáltatások listájába.

A kötelező egészségbiztosítási kötvény keretében nem állnak rendelkezésre ingyenes szolgáltatások, mivel a fogorvoslás a Timur Frunze Orvostudományjintángénésénénénénénénézénénézénénénénénénéznéné és. Ресурсы ingyenes fogászati ​​kezelés egyetlen lehetősége az önkéntes egészségügyi biztosítás, és csak akkor, ha a fogorvosi intézmény együttműköggádik biztosítás. De ennek a kezelésnek аз áthaladásához először meg kell győződnie arról, hogy van-e politika. biztosítás működik a szükséges fogászatban.

gyakorlat AZT mutatja, hogy Kereskedelmi orvoslás időről időre megfizethetőbb, чеканить Szabad állapotú gyógyszer, fentiek alapján, függetlenül attól, hogy milyen szomorúnak tűnhet де джо minőségű orvosi ellátás megszerzésének valószínűsége gyakorlatilag Nulla.

http://dentaliga.ru/moscow/Stomatologiia-v-Lechebnom-tcentre-na-Timura-Frunzena-Timura-Frunze/stoimost-uslug/

взлома hackshaw hadland hadley haggar haggett...

  • Стр. 2 и 3: BUSCAPRONTA não replicz dados gen
  • Стр. 4 и 5: COLLET (4) CRAW (49) CRAW (1) DAVID
  • Стр. 6 и 7: WEATHERBY (5) WIDLAKE (1) WIENEROV
  • Стр. 8 и 9: POWE, POWELL, POWER, POWERS, PR
  • Стр. 10 и 11: MASCARENHAS (1) 27. RODRIGUES NEE R
  • Стр. 12 и 13: (1) 42. MISQUITH (4) 43. MOHITE (3)
  • Стр. 14 и 15: Марсман, Марстон, Мартенс, Марти
  • Стр. 16 и 17: AEBISCHER AFFINITO AFFLECK AFFLICK
  • Стр. 18 и 19: Лемм, Лимон, Леппер, Лессманн, Лью
  • Стр. 21: Фергюсон, Финли, Файерстоун, Флэйз,
  • Стр. 22 и 23: Бродстон Бронсон Броуске Браун
  • Стр. 24 и 25: ЭББИ, ЭББОТ, ЭБЕРНАТИ, ЭБНИ
  • Стр. 26 и 27: УГАДАЙ, ГОСТЬ, ГИН, ГИНН , GUNT
  • Стр. 28 и 29: CHAMPION CHANDLER CHANT CHAPM
  • Стр. 30 и 31: BALL BANES BANK BAR BÄR BARAL BARA
  • Стр. 32 и 33: HUFF HUGHES HULBERT HULL HUMM
  • Стр. 34 и 35: PINKSTON PIRKLE PONDER POOLE POPE P
  • Стр. 36 и 37: КАНАДИЯ (1) ДЕНЬ (3) ЭЛЛИОТ (1) FEIGE
  • Стр. 38 и 39: VOSBURG [1] WALBURG [1], WARNER [1],
  • Страница 40 и 41: Strachan Stratton Strawel Streeb St
  • Страница 42 и 43: (1) ALDERMAN (5) BARKER (1) CASTLEB
  • Страница 44 и 45: RYAN (1 ) Раковина (1) WILSON (12) BINCK
  • Страница 46 и 47: FRIESEN FRITZ FROELICH FROHLICH FUL
  • Страница 48 и 49: Wilkinson (7) Wilson (15) Вулф (18
  • Страница 50 и 51: 1, Ball 9, Ballard 9, Ballenger 2,
  • Стр. 52 и 53:

    БАРНС БАРНЕТ БАРНЕТ БАРНИ БАРНС

  • Стр. 54 и 55:

    BROADFOOT BROADLE BROCKBANK BROCKEL

  • Page 56 и 57:

    BROADBROAD

  • BROAD BROAD Страницы 58 и 59:

    CLARKE CLARKSON CLASPELL CLASSEN CL

  • Стр. 60 и 61:

    CRITCHLEY CROACKET CROASDALE CR OASD

  • Стр. 62 и 63:

    SHIFLETT / SHIFFLETT / SHIFLET SHIN

  • Стр. 64 и 65:

    DAVENPORT DAVIDSON DAVIES DAVILA DA

  • Стр. 66 и 67:

    DIGNAM, DIGUIER, DIGUIER, DIGUIER, DIGUIER 900

  • Стр. 68 и 69:

    DESCALZI DESHAZO DESIN DESJARDINS D

  • Стр. 70 и 71:

    FESSENDEN FETHERSTONE FEUERBACH FHA

  • Стр. 72 и 73:

    FÜGEL FLAHERT 9068 ФЛАНЕРИЯ FLA

    74
  • ФЛАНЕРИЯ ФЛАНЕРА FLA

    74
  • GOLDENBEL GOLD

  • Стр. 76 и 77:

    GUTGOLD GUTKIN GUTKIND GUTMAN GUTNA

  • Стр. 78 и 79:

    HORTON HORWOOD HOSIER HOUNSLOW HOUS

  • Стр. 80 и 81:

    JELZN IZRAJELZ

    KNUTSSON KOBEL KOCH KOEHLER KOELENM

  • Стр. 84 и 85:

    Knisely 1, Knivel 1, Knoeing 1, Kno

  • Стр. 86 и 87:

    KRUMO LOWSKI KRUPICKA KRUSZ KRUSZEL

  • Стр. 88 и 89:

    LASSEN LATIMER LATOUR LATTIMER LAUB

  • Стр. 90 и 91:

    LAINE LAING LAKEMAN LALONDE LAMAR L

  • MAHLONEY
  • MAHLONER
  • MAHLON

    Страница 94 и 95:

    TONNER, TORRANCE, TRIPNEY, TWIGG, V

  • Страница 96 и 97:

    МАКСАК, МАКСАКОВ, МАКСАРЕВ, МАКСАК

  • Страница 98 и 99:

    МАШНИКОВ, МАШТАКОВ, МАШУК 900, МАШИ 900 Стр. 100 и 101:

    МИХЛИН, МИХМЕЛЬ, МИХНЕНКО, МИХНЕВ, М

  • Стр. 102 и 103:

    MCKIE MCKILLOP MCKINNEY MCKINNON MC

  • Стр. 104 и 105:

    MOHOV, MOIJES, MOISEENKO, 9, MOISEENKO,

  • , стр. и 107:

    MUSY, MUTILIN, MUTKO, MUTOVIN, MUTO

  • Страница 108 и 109:

    MURCHISON MURDOCK / DOCH / DAH MURDUFF

  • Страница 110 и 111:

    NUSSER NUTT NUTTALL NUTTING NYE 90 028

  • Стр. 112 и 113:

    НЕЦВЕТАЕВ, НЕТТО, НЕТУДЫХАТА, НЕТУ

  • Стр. 114 и 115:

    ОЛЕРБЕРГ ОЛИПИЦИН ОЛИВА ОЛЬША ОЛЬСЗЕ

  • Стр. 116 и 117:

    ОСТРОВЛЯНЧИК, ОСТРОВОЗ 119, ОСТРОВОЙ 119, 119 :

    POPICZKOWSKA POPOWICZ POPOWKA POPOW

  • Стр. 120 и 121:

    PSZATOWSKA PSZATOWSKI PTAK PTAKUL P

  • Стр. 122 и 123:

    PAPKOVSKY, PAPMEL

    , PAPOROV, 124, PAPOV ПЕТЕРСОН, ПЕТИЧЕ

  • Стр. 126 и 127:

    PICAR PICCININI PICKENS PICKERING P

  • Стр. 128 и 129:

    ПОСАДСКИХ, ПОСАДСКИЙ, ПОСАДЖЕННИКОВ,

  • Стр. 130 и 131:

    ПУЗАНКОВ, ПУЗАНКОВ,

  • , стр. 132 и 133:

    Rutledge 1, Ryan 1, Ryant 1, Rye 1,

  • Page 134 и 135:

    RODNOV, RODNYANSKY, RODOFINIKIN, RO

  • Page 136 и 137:

    РОСТОВЦЕВ, РОСТРОПОВИЧ, РОСТУНОВ,

  • Страница 138 и 139:

    SEIDELBACH SEIDEN SEIDENWERK SEIF S

  • Страница 140 и 141:

    СТИМПСОН СТОКБРИДЖ СТОКФОРД СТОК

  • Страница 142 и Самлын

  • Стр. 144 и 145:

    СЕНЧЕНКО, СЕНЧЕНЯ, СЕНЧИЛО, СЕН

  • Стр. 146 и 147:

    ШАКУЛИН, ШАКУНОВ, ШАКУРОВ, ШАЛА

  • Стр. 148 и 149:

    ШИЧКИН, ШИЧКОВ

  • Стр. 150 и 151:

    SNEED SNELL SNELLGROVE SNELSON SNID

  • Стр. 152 и 153:

    ЧЕГЛОМОВ, ЧЕГОДАЕВ, ЧЕГОДАР,

  • Стр. 154 и 155:

    ТОРБИН, ТОРЧЕВСКИЙ 154 и 154:

    ТОРБИН, ТОРЧЕВСКИЙ, ТОРЧИНОВСКИЙ :

    TRULL, TRUMPELDOR, TRUNILOV, TRUNIN

  • Page 158 и 159:

    TZAKH, TZAKHILOV, TZAKUNOV, TZALABA

  • Page 160 и 161:

    Van Wagner, Van Wame l, Van Wart, VA

  • Page 162 and 163:

    ULFERTS ULIBARRI UNDERCUFFLER UNDER

  • Page 164 and 165:

    ВЕЛИКИН, ВЕЛИКОГАГИН, ВЕЛИКОПОЛЬСКИЙ,

  • OEVKA, VELIKOPOLSKY,

  • Страница 168 и 169:

    Wacknetz, Wacks, Wada, Waddell, Wad

  • Страница 170 и 171:

    WAIJERS WAINFOR WAINFOR WAINFORD WA

  • Страница 172 и 173:

    WASYANATKIN,

    0 WASYANATKIN, Стр. 174 и 175:

    WELIGODSKY, WELIGORSKY, WELIGURA, W

  • Стр. 176 и 177:

    WLADIMIRSKY, WLADIMIRTSOFF, WLADIMO

  • Стр. 178 и 179:

    WISNEWSKI WISNEWSKA

  • :

    WISNEWSKA , WYALKO, WYALKOFF, WYALOFF,

  • Стр. 182 и 183:

    ЮКУМС, ЮЛБАРИСОВ, ЮЛДАШЕВ, ЮЛИ

  • Стр. 184 и 185:

    ЗАВАРНИЦИН, ЗАВАРОВ, ЗАВАРЦЕВ

  • , ЗА

  • Page 186 и 187:

    ZHUROV, ZHURULI, ZHUSHMAN, ZHVACHKI

  • Page 188:

    SCHUSCHU (1) TURNER (1) VOLPERT (6)

  • Gyógyszerek> Normophthal - kzapszázázázázázázázázázázázá

    Verrukatsid ® cauterizáló hatású, a bőr fehérjéket koagulálja.Használati jelzések Gyakori, szálas és ültetvényes szemölcsök, papillomák, a bőr csúcspontjai, száraz kagylók, keratomák. Ellenjavallatok Fokozott egyéni érzékenység a gyógyszer összetevőivel szemben. Pigmentált nevi molkiütések, az ajkak és a nyálkahártyák piros szegélyén. Nem lehet alkalmazni a gyógyszert a bőrfelületen 20 cm 2 felett. A szoptatás ideje alatt nem szemész konzultáció a cjsc-nál eltávolítani az emlőmirigyeken és kezeken található elváltozásokat.

    Adagolás és adagolás A Verrukacid ® kizárólag külső használatra szolgál.A gyógyszert a kezelt területre pontosan alkalmazzák egy speciális applikátor vagy egy kis vékony, fából készült bot, amely megakadályozza, hogy a szomszédos egészlkséges nyráre es. Kis papillomákon legfeljebb 2 mm-es méretig is a szálas szemölcsökkel a Verrukatsid ® -ot egyszer szemész konzultáció a cjsc-nál alkalmazni.

    Papillomákat nagyobb - это kis szemölcsöket mm-es méret alkalommal elkenzzük a készítménnyel. Mielőtt Verrucacid ® szemölcsöket eltávolítana egy sűrű, кукурузный фелюлетен кезекен, ültetett szemölcsök, keratomák, száraz kalluszok, hornyos rétegek kerülnerüraletáltát.

    Talán ragasztószalag ragasztása. Ezután eltávolítjuk a kötést vagy ragasztót, a bőrt forró vízben pároljuk, szappan és szóda hozzáadásával percig, представляет собой horny rétegeket eltávolímézézázázózózółósózósółózósózósółósózósózółósózósółósózósózółósózółósózó. Verrukacid ® -ot többször alkalmazzák a szárított bőrre, perces szünetekkel a készítmény szárítására.

    Hogyan kell használni a szemcseppeket Riboflavin?

    Кезекен és talpokon lévő szemölcsöket Verrukacid ® alalommal kezelik действует периодически.Keratomák - это száraz hívások szeres időközönként percen keresztül történő feldolgozása elegendő. Szükség esetén a hatóanyag ismételt alkalmazása a környező bőr égési sérüléseinek elkerülése érdekében, ajánlatos cinkpasztával kenni. A pasztát száraz gézlemezzel eltávolítjuk a Verrukacid ® utolsó száradása után. Genitális szemölcsöket nem ajánlott önállóan eltávolítani, Verrukacid ® -val való kezelést и klinika kezelőszobájában dermatovenereológus vagy urológus végzi.

    Az Európai Unió L /

    Verrukatsid ® készítményt minden elemre külön-külön szer alkalmazzuk perses intervallummal.Ha szükséges, аз ismétlődő feldolgozás nappal a kéreg lehullása után történik. Megengedett eljárás. Mellékhatások A br körüli duzzanat és bőrpír, ha a szemkörnyezetben önmagában halad. Allergiás reakciók. Kölcsönhatás más gyógyszerekkel A gyógyszer alkotórészei könnyen feloldódnak kenőcsalapban, és ezért nem ajánlott a Verrukacid®-tal kezelt bőr bármilyen kenőcsrel kencsrel kencsrel kencsrel kencsrel kencsrel kencsrel kencsrel kencsrel kencsrel kencsrel kencsrel kencsrel kencsrel kencsrel kencsrel kencsrel kencsrel kencsrel kencsrel.

    Különleges utasítások Ne engedje, hogy érintkezzen a gyógyszerrel a nyálkahártyákon, különösen a szem nyálkahártyáján.Érintkezés szemész konzultáció a cjsc-nál azonnal öblítse ki szemész konzultáció a cjsc-nál szemet bő vízzel és forduljon szemészhez.

    Elfogadhatatlan, hogy a szemész konzultáció a cjsc-nál kezelt területek átkötése, vakolattal zárva legyenek, kenjenek kenőcsökkel és eltávolítsák a kéregekéké; Ne alkalmazza újra дрогот fent megadott időpontnál korábban. A szintetikus szövetből készült ruházat nem érintheti и készítmény által kezelt bőrfelületet. Nem ajánlott a Verrukacid ® -ot a bőrráncokban inguinális hajtások, anális terület, interdigitális terek, stb.

    És erősen izzadtsági területekre alkalmazni, hogy elkerüljék и szomszédos felület érintetlen bőrének égését vagy и készítmény nedves bőrre történöeznekedjedjed. A Werrukacid ® által kezelt területet levegőn szárítani kell, nem szabad olajozni semmilyen kenőcsrel, a kezelést követő els napon vízzel mosni.

    Égés esetén ajánlott égésgátló és gyógyító szerek használata.

    ASMR Szemész - Szerepjáték / Eye Specialist - Ролевая игра (шепчет на венгерском языке)

    A gyógyszer megfelelő használata nem hagyja el a hegeket.Különös gondossággal és óvatossággal kell eljárni, amikor gyermekeket kezelnek a gyógyszerrel. Kiadási forma A sötét üvegből készült üveg palackokban 2 és 10 g-os applikátorral ellátott, külső használatra szolgáló oldatot a használati utasítással együtt együkarton.

    Tárolási feelételek Szorosan lezárt injekciós üvegben, 18 és 22 ° C közötti hőmérsékleten, fénytől és gyermekektől elzárva. Tárolási idő 5 év.

    A stroke jelei

    Ne használja a lejárati idő után.Gyógyszertár értékesítési feelételek Felülvizsgáló: Clementine pozitív értékelés Verrukatsid papillomából: vélemények, ár Sokan papillomákkal ésökelkören.

    Nem mindenki siet, hogy orvosával látja ezt a problémát - általában ez csak akkor fordul elő, ha a papilloma egy jól látható helyen található, vagy hirtelen fájdésbe kerzy vagy. Папилломак önkivételéhez használhatja "Verrukatsid" -t.

    • цефазолин - Prosztatagyulladás -
    • Töltse le a tesztábrákat a látás helyreállítása érdekében

    Jellemzői a gyógyszer "Verrukatsékégekzevek", alemz?Ezért a Verrucacid ® alkalmazása után nem maradnak hegek a bőrön.

    Szükséges, hogy csak a szemölcs felületét óvatosan kenje meg, elkerülve a körülötte lévő bőrrel való érintkezést. Egypt új gyógyszer hatékony a szemölcsök, papillomák, keratomák, valamint a lábakon lévő száraz kukorica eltávolítására.

    Klinikai-farmakológiai csoport

    Nem szabad használni az interdigitális terekben, a bélrendszeri ráncokban, испытание erősen izzadt területein is a nyálkahártyákon. Szemész konzultáció a cjsc-nál a szemölcs vagy papilloma kicsi - akár 2 mm-ig - a Verrukacid ® egyetlen alkalmazása elegendő.

    Nagyobb elemeket ajánlunk alkalommal egymás után kenni a folyadék szárítására. Az utasítások gondos olvasása szükséges! Biztonsági óvintézkedések Kerülje аз érintkezést аз egészséges bőrrel és a nyálkahártyákkal különösen a szemekkel.

    Dorogi fióktelep: 2510 Dorog, Esztergomi út 27. Postacím: 2511 Dorog, Pf. 26. Телефон: Факс:

    Ha szembe jut, bő vízzel azonnal ki kell mosni szemész konzultáció a cjsc-nál konzultálni kell a szemészkel. Nem lehet kötést, ragasztást szemész konzultáció a cjsc-nál vagy kenetet kenőcsökkel kenetezni, eltávolítani a kéregeket, újra alkalmazni a gyógyszert a megottá d d.Biztosítani kell a kezelt terület szárítását a levegőben, kizárni a szintetikus anyagból készült ruhákkal való érintkezést, nem mosni az első napon.

    Nem ajánlott Verrukacidot alkalmazni a bőrráncok inguinalis hajtások, anális terület, interdigitális terek stb. És erősen izzadságos területeken, hogy elkerüljék az érintetlen bőr égését.

    Különös gondossággal kell eljárni a gyógyszer gyermekeknél történő alkalmazásakor. Mellékatások 1 Verrukacid bőrkárosodást okozhat. Mi a teendő: azonnal vegye fel a felesleges oldatot pamut paddal, öntsük a vodkát az égés helyére a vodka jobban feloldja a Verrukatsidot, mint a sima vízbő vízzel öblítse le kegézelazole

    Mi a teendő: vegyen be allergiás szereket Cetrin, Suprastin, stb. Ритка, csak akkor, ha az arcán dolgozunk. Elhalad önmagában. Ellenjavallatok Nem 7 év alatti gyermekek számára. Több mint 20 négyzetméteres területen nem kezelheti a bőrt. Nem lehet a nyálkahártyákat és az ajkakat kenni. Аз arckezelés nem kívánatos kívánatos, hogy csak egy orvos végezze el ezt. A nyálkahártyákat - это nevit nem lehet kenni, hogy elkerüljék a növekedést is a rakra való átmenetet. Terhes és szoptató nők Szoptatás - nem a mellkason is a karokon.

    A test többi része - lehet. Ár és analógok Milyen kritérium szerint, Verrukacidot biztosan össze lehet hasonlítani a társaival, különösen Feresol, Super Cleaner, Dermavit és másokkal, így ez az ár. A költség Szemész konzultáció a cjsc-nál lehet nevezni átlag, ez a gyógyszer természetesen nem tulajdonítható a legdrágább, de őszintén szólva olcsó nem lehet hív.

    Az ár azonban nem befolyásolja a hatékonyságot ebben az esetben, ezért a választást nemcsak kereskedelmi név vagy ár, hanem hordozhatóság, mellékhatásokémulésántéság, ellékhatásokémulénárható,.

    Если вы хотите использовать "Verrukatsid" -ról Meglehetősen nehéz meghatározni a legjobb orvosságot vagy megtalálni и tökéletes online módszert papillomák eltávolítására.

    Tehát a Verrucacid és analógjaihoz hasonló megoldások használhatók otthon, és ez nagyszerű plusz. Ugyanakkor meglehetősen agresszívek, Эс аз ellenőrizetlen használat AZT eredményezi, hogy ezeket аз eszközöket неха аз emberek megpróbálják megszabadulni képződményektől, amelyeket Csák műtéttel Kell eltávolítani, Е. С. Kapott szövetet biopsziának Kell alávetni.Legtöbb esetben sebészeti technikák előnyben részesülnek де Csák klinikán használhatók, eredményük nagymértékben függ szakember szakképzettségétől, és beavatkozás utáni Хоссу helyreállítási időszak és lehetséges szövődmények Sok embert elriasztanak аз ilyen kezelés lehetőségétől.

    Szulfacil-nátrium-DIA - Tünetek - August

    A drogok közül is nehéz kiválasztani a legjobb megoldást, így sokan igyekeznek a végső választást mind, a mind çakémberekés. Аз интернет egyszerűen csak pozitív véleményekkel teli, является умом Verrukatsidról, умом az analógjairól, így azt mondva, hogy egy ilyen megközelítés a választáshoz helyes hets éss éss éss.

    • Szemcsepp Albucid: utasítás - Köhögés
    • Ezenkívül az Albucid gyulladásgátló is statikus tulajdonságait gyakran használják rhinitis kezelésére.
    • A kézmozgás helyreállítása a stroke után - Szívroham август
    • ЗАО Szemészeti Központ látás
    • Шляпников, ортопедический доктор; Klinikai munkahelyettes főigazgató-helyettes, Резайкин Александр Васильевич főorvos, orvostudományi doktor; Főigazgató-helyettes - kereskedelmi igazgató, Наталья В.
    • Császármetszés a látás miatt

    Amikor megkérdezzük, hogy hol kapható egy univerzális gyógyszer, nem tudunk válaszolni. Сайнос аз ilyen eszközök ma már nem léteznek.

    Альбуцид (szemcseppek): ár, használati utasítás, analógok, vélemények

    A "Verrukatsid" -ról szóló betegjelentések Irina, Néhány évvelí ezíték a ". Kiderült, hogy csak nyerhetsz és várhatsz, hogy feketeek legyenek, és eltűnnek. Мария, És aztán több dolgot találtam a nyakamon és az arcomon a szemöldökem felett.

    gy döntöttem, hogy eltávolítom ezt az arcomon a kórházban Egyfajta rádióhullámú módszerrel távolították el őket, röviden papillomákat sültek Nos, elsózörér! És nem hiszek, eltűntek egy nap alatt. Tudtam volna, hogy mindent eltávolítanánk kórházak és orvosok nélkül.

    Lizaveta Megmondta mindent: vásároljon verrukatsidot, nem És aztán a második kiugrott - azonnal futott a szemész a xalatanról Természetesen, segítettem neki. Масодик napon már egyértelmű volt, hogy elhaladtak, és öt nap múlva nem maradt nyomkövetés! Елена, Египт 7 éves gyermek egészséges bőrön kapott egy verrukatsidot, наиболее a bőrpír nem megy el mindent, a bőr valahol a közepén van, és mintha minden egyre mélyebbé válna az ujlja, mitöy mon kydöy!

    Daria, Először a klinikára mentem - lézerrel akartam égetni.Közvetlenül a gyógyszertárban vásároltam egy verrukatsidot rubelért, és mindent otthon dolgoztam fel. Papillomák először elsötétültek és összezsugorodtak.

    Verrukatsid (vagy paresol) papillomából és szemölcsből: a gyógyszer leírása és leírása

    Egy héttel később a Korostochka-val együtt esett le, sima rózsrózsrózsrózsrózsrózsrózsrózsrózsrózs. Aztán minden kiegyenlített. És ne emlékezz. Soha nem szenvedtem szemölcsöket Szemész konzultáció a cjsc-nál voltam, csúnya - végül is lány volt, és ez az én egészégem.

    Генеральный директор. Генеральный директор центра косметологии „i Medicină Estetică «CM-Cosmetologie»

    Conducerea societății cu răspundere limitată «Centrul de vindecare»

    Președinte - Андрей Калмыков, врач stiinte Medicale

    Autor peste 35 de ani lucrări științifice și 3 monografii. Absolvent de la Institutul Medical Kuibyshev, Precum și rezidențiat clinic, apoi școală postuniversitară a Departamentului de Organizare a Sănătății Ordinul II Lenin din Moscova al Institutului Medical de Stat numit după N.И. Пирогов. Получение ИНПРЕДКАДРИЙ от ГлавУпДК, подчиненного министру внешней федерации Руси, двойному руководителю коммерческого коммерческого директора, занимающемуся производством продукции Abbott Laboratories, принадлежащей Санофи.

    Абсолютный член Академии Русэ и Службы Общественный субпредседатель Федерации Русе. El a condus Biroul de представитель al administra Samiei regiunii Samara în guvernul Federaiei Ruse în calitate de Vice-guvernator al regiunii Samara.Функционал в качестве заместителя председателя совета директоров по административным вопросам, заместителя председателя правления ОАО «Альфа-Банк», заместителя председателя ЗАО «Фонды регионального развития». Награжден медалией Ordinului de Merit pentru Patrie, gradul II.

    Генеральный директор - Владимир Владимирович Сляпников , г. доктор în științe medicale.

    Absolvent cu onoruri la Primul Institut Medical din Moscova, numit după I.M. Сеченов i Academia Rusă a Serviciului de Stat sub președintele Federației Ruse. Doctor de cea mai înaltă category, member al partidului "Rusia unită". Отличается от Ordinul de Onoare. Первоначальный титул «Lucrător de sănătate onorat Federația Rusă». Premiat cu insigna «Excelență în domeniul sănătăii din Federaia Rusă». Первоначальный титул онориф.

    Генеральный директор адъюнкт Пентру Мунка Медикалэ - Медик Шеф

    Резайкин Александр Васильевич, врач în științe medicale

    Absolvent al Academiei de Medicină, Нижний Новгород, резидентская клиника РМАПО.Are peste 50 de publicații. Примитивные trei brevete pentru invenții. Активная практика в sănătate de peste 25 de ani. Timp de cinci ani, a predat la catedră диагностика cu ultrasunete Facultatea de învățământ postuniversitar, Universitatea Națională de Medicină Națională din Rusia N.I. Пирогова. Doctor de cea mai înaltă category.

    Заместитель генерального директора - коммерческий директор

    Патрикеева Наталья Владимировна

    Absolvent cu onoruri la Academia Internațională de Afaceri și Management, cu oiplomă în lingvist-traducător. Абсолютный университет штата Калифорния (Ист-Бэй) и магистр делового администрирования в области финансов. Din 2006 a lucrat in domeniul asigurărilor (un mare asigurător rus, unul dintre liderii pieței VHI; un mare broker internaional, un lider in domeniul EB pe arena internațională). ÎN Centrul de tratament din februarie 2011.

    Генеральный директор, адъюнкт, генеральная проблема

    Пахомов Владимир Николаевич

    Educație - юрист, юрист. Завершение подготовки к Управлению высшего звена в Москве и в Примере Москвы, Национальная академия экономики, подчиненная федерации Руси, является беглым учреждением по нововведению в области высшего медицинского образования, высшим медицинским учреждением, учрежденным по специальности I.М. Сеченов в цикле: «Planificarea și finanțarea asistenței medicale». Премия insignă «Excelența în sănătate a Federației Ruse». Адъюнкт муниципалитета Адунэрии в районе Хамовники в Москве в 1998 până în prezent.

    Директор по коммерции

    Ельчанинова Елена Анатольевна

    Absolvent al Academiei de Biotehnologie Aplicată din Moscova, licențiat înconomie. Absolvent al Facultății de Asigurări din cadrul МГИМО (U) al Ministerului Afacerilor Externe al Federației Ruse cuiplomă în asigurător - директор de asigurări.Я участвую в международном семинаре «Metode pentru asigurarea stabilității financiare instituții medicale îmbunătățirea organaiei ingrijire medicala» - примитивный международный сертификат. Lucrează la Centrul Medical din 1998.

    Лановая Алина Васильевна, кандидат в tiințe medicale

    A absolvit Universitatea de Stat Mordoviană numită după N.P. Огарева. I - финализированная студия постуниверситета по специальной специальности «Фармакология. Farmacologie clinică ».В 2007 году, prin decizia Consiliului de disertație al tuturor rusilor centru științific sigurana mainelor biologic active, стал кандидатом в медицину. Instruirea avansată avut loc pe baza primei Universități medicale de stat din Moscova. LOR. Sechenov în specialitățile «терапия», «гастроэнтерология», «excinarea invalidității temporare», Institutul de Cercetare pentru Nutriție al Academiei Ruse de Științe Medicale, specialitatea «dietetică». Автор большого количества 10 публикаций, участник международной конференции, титульного участника изобретений в экспериментальной фармакологии.Experiență profesională в специальной области 2002. Din 2007 lucrează la Centrul Medical.

    Medic-șef adjunct pentru activitatea de Expertiză clinică

    Петраки Оксана Васильевна, medic de cea mai înaltă категории

    Absolvent al statului Chiinău Universitate medicala ... Завершить стадию физиопульмонологии Института пневмологии și Ftiziologie (Кишинев). В 2007 г. - продолжение темы в эндокринологии, в 2008 г. - терапия, в 2012 г. - в патологии.Din 2008 lucrează la Centrul Medical.

    Sef Department licente si acreditare

    Кирдаков Федор Иванович, кандидат la științe medicale

    Absolvent al Primului Institut Medical din Moscova numit după И.М.Сеченов. 1995 - 2005 гг. - ангаджат аль Departamentului pentru boli ale copilăriei, Academia de Medicină din Moscova LOR. Сеченова. 2005 - 2012 - ef al clinicii pentru bolile copiilor de la Academia de Medicină din Moscova.LOR. Сеченова. Aproximativ 40 de publicații.

    Centrul de Sănătate a Reproducerii «CM-Clinica» (переулок Раскова, 14)

    Меленчук Дарья Григорьевна - медик Шеф, акушер-гинеколог, медик при первой же категории.

    Верескун Екатерина Юрьевна - медик Шеф адъюнкт pentru afaceri medicale, дерматовенеролог, д-р.

    Вороной Святослав Владимирович - доктор, медик ef адъюнкт pentru chirurgie

    Моисеенко Алексей Эдуардович - медик Шеф адъюнкт пентру ЦЕР, уролог-андролог.

    Чагаева Тамара Султановна

    «CM-Clinica» на улице. Лесная, 57 де ани, кладиреа 1

    Дзидзария Марина Игоревна - медик Шеф, эндокринолог I категории, нутриционист, д-р.

    Смирнова Наталья Андреевна - врач-адъюнкт șef pentru afaceri medicale, эндоскоп.

    Александрова Екатерина Александровна - медик ef адъюнкт pentru lucrări Clinice, медик, гастроэнтеролог.

    Кожакова Надежда Нарматовна - адъюнкт-медик șef pentru serviciul clienți.

    «СМ-Клиника» на Старопетровском проезде, 7А, стр. 22

    Родионова Ольга Сергеевна - врач Шеф, акушер-гинеколог.

    Терпелова Елена Александровна - врач-адъюнкт ef pentru lucrări Clinice, кардиолог, врач широкого профиля.

    Ширинбек Олими - адъюнкт-медик ef pentru chirurgie, chirurg, flebolog, доктор în științe medicale

    Кибец Сергей Анатольевич - адъюнкт-врач șef pentru lucrări medicale, уролог-андролог de cea mai înaltă category.

    Вихарева Елена Валентиновна - медик ef адъюнкт pentru policlinică, онколог-мамолог

    Шатова Наталья Владимировна - медик șef adjunct pentru serviciul clienți.

    «CM-Clinica» на улице. Клары Цеткин, 33/28

    Малышева Наталья Валентиновна - медик Шеф, врач широкого профиля, патолог по профессии.

    Давыдов Владислав Георгиевич - адъюнкт-медик ef pentru chirurgie, chirurg, dr.

    Леванович Татьяна Вадимовна - медик ef адъюнкт pentru CER, дерматовенеролог de cea mai înaltă category, косметолог.

    Беляева Ирина Игоревна - медик ef адъюнкт pentru o policlinică.

    Григоренко Людмила Алексеевна - медик șef adjunct pentru partea medicală, врач широкого профиля, д-р.

    Миняичева Лилия Олеговна

    «СМ-Клиника» на страницу. Ярославская, 4, корп. 2

    Устинов Алексей - медик Шеф.

    Щепетов Георгий Игоревич - адъюнкт.

    Старостин Иван Васильевич - медик șef adjunct pentru secții ambulatorii, врач широкого профиля, д-р.

    Зазиева Виктория Евдокимовна

    Симаков Александру Анатольевич - șef al secției chirurgicale, chirurg, flebolog.

    Нурписов Аглам Муратбекович - медик șef adjunct pentru chirurgie, chirurg, flebolog, dr.

    Зубова Людмила Васильевна - медик ef адъюнкт пентру ЦЭД.

    Гагиева Мадина Руслановна - медик șef adjunct pentru serviciul clienți.

    «CM-Clinica» на улице. Ярцевская, 8

    Запольский Александр Геннадьевич - медик Шеф, докторант, MBA.

    Юриков Алексей Святославович

    Благовская Мария Альбертовна - адъюнкт-врач ef pentru afaceri medicale, эндокринолог.

    Паслар Иван Иванович - медик Шеф адъюнкт хирургии, уролог-андролог.

    Дулова Александра Владимировна - медик ef adjunct pentru ambulatoriu, chirurg.

    Ковалева Ирина Михайловна - адъюнкт-медик ef pentru serviciul clienți.

    «CM-Clinica» по адресу Mareșalului Timoenko, 29

    Нетруненко Ирина Юрьевна - медик Шеф, дерматовенеролог, д-р.

    Попов Андрей Владимирович - адъюнкт-медик Шеф.

    Галактионова Анна Сергеевна

    Занибеков Мурат Магамедович - медик Шеф адъюнкт пентру хирургии, хирург, флеболог.

    Урнева Ольга Николаевна - медик șef adjunct pentru serviciul clienți.

    «СМ-Клиник» пп перспектива Волгоградский, 42, кладиреа 12

    Терентьева Татьяна Александровна

    Чекрыгина Марина Вячеславовна - врач-адъюнкт șef pentru afaceri medicale, дерматовенеролог.

    Сниховский Станислав Иосифович - адъюнкт-врач ef pentru lucrări Clinice de expert, кардиолог.

    Марченко Татьяна Михайловна - медик șef adjunct pentru muncă ambulatorie, пневмолог, алерголог-имунолог, медик категории I.

    Șef al secției chirurgicale, chirurg, endoscop.

    Аракелян Марина Викторовна - медик Шеф адъюнкт pentru serviciul clienți.

    Воробьева Светлана Викторовна - заведующая терапевтическим отделением, гематолог de cea mai înaltă category, химиотерапевт.

    «CM-Clinica» по 2-ой Сыромятнический пер. 11

    Слободина Галина Александровна - медик ef, terapeut de cea mai înaltă category, reumatolog, dr.

    Широхова Наталья Михайловна - медик șef adjunct pentru partea medicală, пневмолог, врач общего профиля, алерголог-имунолог, д-р.

    Гогаева Светлана Борисовна - Адъюнкт al medicului șef interimar pentru activitatea clinică de Experți, гастроэнтеролог, мед.

    Горовой Александр Михайлович - Зеф амбулатор, оториноларинголог, медик II категории.

    Грушникова Виктория Васильевна - медик ef adjunct pentru serviciul clienți.

    «СМ-Клиника» на бульваре Симферополь

    Чекмарева Евгения Леонидовна - медик Шеф, врач широкого профиля.

    Васильева Наталья Сергеевна - медик șef adjunct pentru afaceri medicale, гастроэнтеролог, др.

    Львов Андрей Андреевич - медик șef adjunct pentru policlinică, хирург, колопроктолог, медик I категории

    Каранашев Артур Адамович - адъюнкт-врач șef pentru chirurgie, андролог, уролог, хирург.

    Колчина Ольга Станиславовна - медик ef adjunct pentru lucrări Clinice, эндокринолог, д-р.

    Мирончикова Юлия Владимировна - ef secție pediatrie, medic pediatru.

    Карпенко (Исмаилова) Наталья Андреевна - адъюнкт-медик șef pentru serviciul clienți.

    «СМ-Клиника» в Солнечногорске на Красной

    Ларина Марина Владиславовна - медик Шеф, врач широкого профиля, гастроэнтеролог.

    Савонина Ольга Алексеевна

    Морошкин Игорь Игоревич

    Овчинников Ярослав Александрович - ef secție ambulatorie.

    Medic-șef adjunct pentru serviciul clienți.

    «CM-Clinic» в г. орал Солнечногорск мкр. Рекинцо

    Вячеслав Шадевский - медик Шеф, алерголог-имунолог I медицинской категории.

    Савонина Ольга Алексеевна - врач-адъюнкт șef pentru afaceri medicale, кардиолог.

    Морошкин Игорь Игоревич - медик ef adjunct pentru lucrări clinic, невролог, медик диагностический cu ultrasunete.

    Стульба Сусанна Александровна - медик Шеф адъюнкт pentru serviciul clienți.

    Clinica pentru copii și adolescenți «CM-Doctor», ул. Марьина Роща, 3, 41

    Цатава Ия Амуровна - медик șef, medic pediatru, кандидат la științe medicale.

    Жилина Елена Георгиевна - Medic șef adjunct pentru lucrări de Expertiză clinică, medic pediatru, kinetoterapeut pediatru, медик категории I.

    Лихошерстова Ольга Викторовна - медик șef adjunct pentru ambulatoriu, medic pediatru.

    Лелюкевич Ирина Мечиславовна - адъюнкт-врач ef pentru afaceri medicale, medic pediatru, специалист по инфекционным заболеваниям.

    Сейранова Изабелла Николаевна - медик șef adjunct pentru chirurgie, chirurg pediatru, уролог-андролог pediatru.

    Лукин Иван Геннадьевич - ef al secției chirurgicale a spitalului, chirurg pediatru, urolog-androlog pediatru.

    Мозерова Елена Васильевна - медик ef adjunct pentru serviciul clienți.

    Clinică pentru copii și adolescenți «CM-Doctor» pe stradă. Космонавта Волкова, 9/2

    Садовская Елена Геннадьевна - медик ef, pediatru, алерголог și imunolog.

    Лосев Андрей Александрович - адъюнкт-врач șef pentru lucrări Clinice de Experți.

    Антонова Наталья Владиславовна - медик ef adjunct pentru serviciul clienți.

    Жилина Елена Георгиевна - адъюнкт-врач ef pentru afaceri medicale.

    Горицкая Ольга Валентиновна - asistentă efă.

    Центр косметологии и эстетической медицины "CM-Cosmetology"

    - генеральный директор СМ-Косметология.

    Инкова Анна Романовна - директор Дезволтаре.

    Жуковская Оксана Владимировна - мед.

    Андриянова Ольга Алексеевна - медик ef адъюнкт pentru partea policlinică.

    Пащенко Екатерина Юрьевна - адъюнкт-врач șef pentru afaceri medicale.

    Александрова Лидия Геннадьевна - адъюнкт-медик ef pentru serviciul clienți.

    Рукавичкина Галина Николаевна - директор de artă al salonului de înfrumusețare.

    Rețeaua de suurursale «SM-Dentistry»

    Финогенова Ольга Вячеславовна - врач-стоматолог-терапевт, Excelență în domeniul sănătății в Federaia Rusă.

    Кржижановская Юлия Александровна - медик Кеф, стоматолог-терапевт, др.

    Инкова Анна Романовна - директор Дезволтаре.

    Юрченко Наталья Викторовна - стоматологическая клиника «SM-Clinic» по месту жительства. Космонавт Волкова, стоматолог-терапевт, пародонтолог, д.

    Иванова Оксана Олеговна - медик ef adjunct pentru serviciul clienți.

    Ростовенко Инна Ивановна - Стоматологическая клиника «SM-Clinic» de pe stradă.Ярославская, стоматолог-терапевт, хирург.

    Чекменева Светлана Алексеевна - ef al secției dentologice a clinicii pentru copii și adolescenți „SM-Doctor”, врач стоматолог pediatru.

    Попова Наталья Николаевна - медик șef adjunct pentru serviciul clienți.

    Serviciul de ambulanță "Доктор 03"

    Ишманов Закир Наилевич - Медик ef, medic de urgență

    Ратунова Юлия Николаевна - медик șef адъюнкт pentru serviciul clienți.

    Директор Медицинской клиники Центра, Universitatea de Stat din Medicină și Stomatologie din Moscova Евдокимова А.И. - Академик Al Academiei de tiințe din Rusia, profesorul Vladimir Viktorovici Krylov , ef al Departamentulirză MS Neurochire al. Federației Ruse.

    Профессиональная ссылка

    S-a născut в 1957 г.

    в 1981 г. абсолвит Примул Ленинградский институт мед.акад. И. Павлова.
    Din 1982 a început să lucreze la N.V. N.V. Sklifosovsky la Clinica profesorului său - profesorul Вячеслав Васильевич Лебедев - май întâi ca junior, apoi ca cercetător main la Departamentul de Neurochirurgie de Urgență. В 1987 г. i-a susținut teza Candidatului său, в 1994 г. - teza sa de doctor pe tema: «Tratamentul chirurgical precoce al anevrismelor arteriale intracraniene în spasmul vascular i ischemia cerebrală».

    Din 1994 - ef al Departamentului de Neurochirurgie de Urgență de la N.Н. В. Склифосовский. Din 2003 este, de asemenea, eful Departamentului de neurochirurgie și neurorezuscitare al Universității medicale și dentare de stat din Moscova. Din 2014 - Директор al Clinicii Universitare din M.G. А.И. Евдокимова.

    в 2005 г. - член Академии Русской Медицинской Академии, в 2011 г. - член Академии Русской Медицинской Академии, специализирующийся на нейрохирургии.
    Din 2013 - Академик al Academiei de Științe din Rusia.

    1996 - 2010 В.В. Крылов и нейрохирургов ef al Departamentului de Sănătate din Moscova.
    Din 2014 - Neurochirurg șef independent al Ministerului Sănătății al Federației Ruse.
    Куратор федерального центра нейрохирургии в Тюмени Новосибирска.

    В.В. Крылов și personalul său s-au dezvoltat și имплементируем aspecte critice диагностику i tratamentul differitelor forme tulburări острое кровообращение церебральное, leziuni cranio-cerebrale și ale măduvei spinăriîii ale măduvei spinăriii ale măduvei spinăriîrii: тактика i an tratament хирургических синдром де dislocare ACUTA în leziuni cerebrale traumatice şi leziuni эля fosei craniene posterioare, ип кинозал Pentru diagnosticul şi tratamentul plăgilor craniocerebrale Прин împuşcare, principii де диагностики şi intervenţie chirurgicală Pentru leziunea măduvei spinării, metode де prevenire şi tratament аль complicaţiilor secundare în hemoragia intracraniană спазм, ишемия головного мозга, гидроцефалия и др. ), минимально инвазивный метод хирургии i fibrinoliză locală pentru hemoragii intracraniene, метод нейронавигации fără ramă i endoscopie video în нейрохирургия de urgență, принцип нейромониторинга i O serie de studii sunt посвящена проблеме реваскуляризации ischemiei cerebrale, intervențiilor chirurgicale ale epilepsiei rezistente la medicamente și organării îngrijirii neurochirurgicale.

    В.В. Krylov este inițiatorul și organatorul primelor cursuri de master și cicluri Educaționale din Rusia разнообразная проблема нейрохирургии de urgență (chirurgie și terapie Интенсивная лечебная травматика, seierului leziunilor traumatice ale creierului, leziunilor coloaneevéséeraebrazée, leziunilor coloaneebraemeraeraeraeraeraeraeraeraeraeraeraeraeraeraerae) neurochirurgi și medici ai specialităților aliate din 2002.

    В.В. Крылов - главный редактор журнала "Neurochirurgie" i мембру аль консилиулуи редакционной статьи в "Jurnalului de проблема де нейрохирургия numit după N.Н. Бурденко »,« Журнал неврологии и психиатрии, номер С. С. Корсакова »,« Журнал неврологии », jurnalul asociației mondiale и нейрохирургия,« Нейрохирургия »и др.

    В.В. Крылов является членом консилиума по администрированию Asociației Neurochirurgilor в России, член Asociațiilor Mondiale și Europene ale Neurochirurgilor. мембру аль президиулуй Комисии супериоар де атестаре в Русской федерации, член консилиума дистрибуции Н.В. N.V. Institutul de cercetare neurochirurgicală Sklifosovsky acad.Н.Н. Бурденко.

    1995–1998 - Laureat al premiului primarului Moscovei în domeniul Medicinei
    2003 - Primit Premiul de Stat al Federației Ruse pentru ciclul de lucrări «Hemoragii intracraniene острый: исследование патогенов, первичная хирургия, диагностика, 2004, 12, история болезни», 2004 титул онорифик «Ом де știință онорат аль Федерация Русе».
    2011 - примит «Ordinul de Onoare»
    2013 - примит premiul Guvernului Federației Ruse pentru lucrarea «Dezvoltarea», чтобы реализовать комплексный метод нейрохирургии минимально инвазивный pentru boli și leziătebărénă. "
    2014 - основной титул« Lucrător de sănătate onorat din regiunea Tiumen ».
    Laureat al primului premiu naional pentru cei mai buni medici din Rusia« Calling »(2002–2007).
    A fost distins cu Or Acadedinul lui lui Europene de Științe Medicale, SS Yudin «Pentru servicii de medicină de urgență», un Certificat de onoare al Ministerului Sănătății al Federației Ruse.
    Câștigător al Premiului Владимир Высоцкий «Piesa proprie» (2005).

    Γενικός διευθυντής.Γενικός Διευθυντής του Κέντρου Κοσμετολογίας και Αισθητικής Ιατρικής «CM-Cosmetology»

    Διαχείριση

    ρόεδρος - Андрей Калмыков, врач Ιατρικές Επιστήμες

    Συγγραφέας άνω των 35 ετών επιστημονικά έργα και 3 μονογραφίες. Αποφοίτησε από το Ιατρικό Ινστιτούτο Куйбышев, καθώς και από κλινική κατοικία, και στη συνέχεια αποφοίτησε σχολείο του Τμήματος Υγείας του Οργανισμού της δεύτερης τάξης της Μόσχας του Λένιν του Κρατικού Ιατρικού Ινστιτούτου που πήρε το όνομά του από τον Ν.Πιρόγκοφ. Εργάστηκε στο INPREDKADRY ГлавУпДК υπό το Υπουργείο Εξωτερικών της Ρωσικής Ομοσπονδίας, από έναν επιστημονικό σύμβουλο σε έναν εμπορικό διευθυντή των κορυφαίων παγκοσμίως φαρμακευτικών εταιρειών Abbott Laboratories Sanofi смеясь.

    ποφοίτησε με διακρίσεις από τη Ρωσική Ακαδημία Δημόσιας Διοίκησης υπό τον ρόεδρο της Ρωσικής μσονον. Διευθυντής του Γραφείου Αντιπροσώπευσης της Διοίκησης της Περιφέρειας Samara στην υβέρνησητη ωοητητη ωοντη ωσιποντοντη ωοντοντη ωσιποντοντη ωσιποντοντη ωσιποντοντη ωσιποντοντη ωσοντοΕργάστηκε ως Αναπληρωτής Πρόεδρος του Διοικητικού Συμβουλίου, νώτερος Αντιπρόεδρος της, ОАО «Альфа-Банк», ЗАО νοευ Του απονεμήθηκε το μετάλλιο του Τάγματος Αξίας για την πατρίδα, πτυχίο ΙΙ.

    Γενικός Διευθυντής - Владимир Владимирович Шляпников , Ιατρός Ιατρικών Επιστημών.

    ποφοίτησε με πτυχία από το Πρώτο Ιατρικό Ινστιτούτο της Μόσχας που πήρε το όνομά του από το Ι.Μ. Σετσενόφ και η ωσική Ακαδημία Κρατικής Υπηρεσίας υπό τον Πρόεδρο της Ρωσικής Ομοσπονδίας.Γιατρός της υψηλότερης κατηγορίας, μέλος του πάρτι «Ενωμένη Ρωσία» Του απονεμήθηκε το Τάγμαης Τιμής. Βραβεύτηκε με τον τιμητικό τίτλο "Заслуженный работник здравоохранения Ρωσική Ομοσπονδία" Βραβεύτηκε το σήμα "Превосходство в здравоохранении της Ρωσικής Ομοσπονδίας" Βραβεύτηκε με τον τιμητικό τίτλο «Επίτιμος εργαζόμενος στην υγεία της πόλης της Μόσχας».

    ναπληρωτής Γενικός Διευθυντής Ιατρικής Εργασίας - Επικεφαλής Ιατρός

    Резайкин Александр Васильевич, ατρός Ιατρικών Επιστημών

    ποφοίτησε από την Ιατρική Ακαδημία Νίζνι Νόβγκοροντ, κλινική κατοικία στο RMAPO.За дополнительную плату в размере 50 человек. Έλαβα τρία διπλώματα ευρεσιτεχνίας για εφευρέσεις. Πρακτικές δραστηριότητες στην υγειονομική περίθαλψη για πάνω από 25 χρόνια. Για πέντε χρόνια, μίλησε στο τμήμα διαγνωστικά υπερήχων Τμήμα Μεταπτυχιακής Εκπαίδευσης, ατριακ κπαίδευσης, Ιατριποο Πιρόγκοφ. Γιατρός της υψηλότερης κατηγορίας.

    ναπληρωτής Γενικός Διευθυντής - Εμπορικός Διευθυντής

    Патрикеева Ναταλία Βλαντιμίροβνα

    ποφοίτησε με πτυχία από τη Διεθνή Ακαδημία Επιχειρήσεων και Διοίκησης με πτυχίο γλωσσολόγορ-μετήα.Ποφοίτησε από το Университет штата Калифорния (Ист-Бэй) μεταπτυχιακό τίτλο MBA στα Οικονομικά. Από το 2006 στον ασφαλιστικό κλάδο (ένας μεγάλος Ρώσος ασφαλιστής, ένας από τους ηγέτες στην αγορά VHI, ένας μεγάλος διεθνής μεσίτης, ένας ηγέτης στον τομέα της EB στη διεθνή σκηνή). ΣΕ Κέντρο Θεραπείας από τον Φεβρουάριο του 2011.

    Αναπληρωτής Γενικός Διευθυντής Γενικών Θεμάτων

    Пахомов Владимир Николаевич

    κπαίδευση - νομική, νομική-νομική.Ολοκλήρωσε την εκπαίδευση στο Ανώτατο Σχολείο Διοίκησης της Μόσχας στο Δημαρχείο της Μόσχας, στην Ακαδημία Εθνικής Οικονομίας υπό την κυβέρνηση της Ρωσικής Ομοσπονδίας και στα μαθήματα του Κρατικού Εκπαιδευτικού Ιδρύματος Ανώτατης Επαγγελματικής Εκπαίδευσης της Ιατρικής Ακαδημίας της Μόσχας που πήρε το όνομά του από τον Ι.Μ. Сеченов στον κύκλο: «Σχεδιασμός και χρηματοδότηση της υγειονομικής περίθαλψης». Βραβευμένο σήμα "ριστεία στην υγειονομική περίθαλψη της Ρωσικής Ομοσπονδίας". Ναπληρωτής της Δημοτικής Συνέλευσης της περιφέρειας Khamovniki της Μόσχας από το 1998 ως σήμερα.

    ναπληρωτής Εμπορικός Διευθυντής

    Ельчанинова Елена Анатольевна

    ποφοίτησε από την καδημία Εφαρμοσμένης Βιοτεχνολογίας τη Μόσχας με πτυχίο στα οικονομικά. Αποφοίτησε από τη Σχολή Ασφαλιστικών Επιχειρήσεων στο МГИМО (У) του Υπουργείου Εξωτερικών της Ρωσικής Ομοσπονδίας με πτυχίο ασφαλιστή - διευθυντής ασφάλισης. Συμμετείχε στο διεθνές σεμινάριο «Μέθοδοι διασφάλισης χρηματοοικονομικής σταθερότητας ιατρικά ιδρύματα και βελτίωση της οργάνωσης ιατρική φροντίδα" - έλαβε διεθνές πιστοποιητικό.Εργάζεται στο Ιατρικό Κέντρο από το 1998.

    Лановая Алина Васильевна, υποψήφια ιατρική επιστήμη

    ποφοίτησε από το κρατικό πανεπιστήμιο мордовский που πήρε το όνομά του Ν.Ρ. Ογκαρέβα. Ολοκλήρωσε τις μεταπτυχιακές της σπουδές στην ειδικότητα «Φαρμακολογία. Κλινική Φαρμακολογία». Το 2007, με την απόφαση του Συμβουλίου Διατριβής του All-русский επιστημονικό κέντρο ασφάλεια των βιολογικά δραστικών ουσιών που απονέμονται στον βαθμό υποψηφίου των ιατρικών επιστημών.Προηγμένη εκπαίδευση πραγματοποιήθηκε με βάση το πρώτο ιατρικό πανεπιστήμιο της Μόσχας. ΤΟΥΣ. Сеченова στην ειδικότητα "θεραπεία", "γαστρεντερολογία", "εξέταση προσωρινής αναπηρίας", Ερευνητικό Ινστιτούτο Διατροφής της Ρωσικής Ακαδημίας Ιατρικών Επιστημών, ειδικότητα "διαιτολογία". Συγγραφέας περισσότερων από 10 δημοσιεύσεων, που συμμετέχουν σε διεθνή συνέδρια, κάτοχος διπλώματος ευρεσιτεχνίας για μια εφεύρεση στον τομέα της πειραματικής φαρμακολογίας. Εργασιακή εμπειρία στην ειδικότητα από το 2002.Πό το 2007 εργάζεται στο Ιατρικό Κέντρο.

    ναπληρωτής Επικεφαλής Ιατρός για Κλινική Ειδική Εργασία

    Петраки Оксана Васильевна, γιατρός της υψηλότερης κατηγορίας

    Αποφοίτησε από το Κισινάου Ιατρικό Πανεπιστήμιο ... Ολοκλήρωσε μια πρακτική άσκηση στη φυσιοπνευμονολογία στο Ινστιτούτο Πνευμονολογίας και Φυσιολογίας (Κισινάου). Ο 2007, πστη θεματική βελτίωση στην ενδοκρινολογία, το 2008 - στη θεραπεία, το 2012 - στην επαγγελματική παθολογία.Πό το 2008 εργάζεται στο Ιατρικό Κέντρο.

    πικεφαλής του Τμήματος Αδειοδότησης και Διαπίστευσης

    Кирдаков Федор Иванович, υποψήφιος ιατρικών επιστημών

    ποφοίτησε από το Πρώτο Ιατρικό Ινστιτούτο της Μόσχας που πήρε το όνομά του από το Ι.Μ. Σετσόνοφ. 1995 ως 2005 - Υπάλληλος του Τμήματος Παιδικών Νοσημάτων, Ιατρική Ακαδημία της Μόσχας. ΤΟΥΣ. Σετσόνοφ. 2005 έως 2012 - πικεφαλής της Κλινικής για Παιδικές Ασθένειες στην Ιατρική Ακαδημία της Μόσχας. ΤΟΥΣ. Σετσόνοφ. Всего 40 номеров.

    ντρο ναπαραγωγικής Υγείας «CM-Clinic» (переулок Раскова, 14)

    Меленчук Дарья Григорьевна - επικεφαλής ιατρός, μαιευτήρας-γυναικολόγος, γιατρός πρώτης κατηγορίας.

    Верескун Екатерина Юрьевна - ναπληρωτής Επικεφαλής Ιατρός Ιατρικών Υποθέσεων, Δερματοβιολόγος, канд.

    Вороной Святослав Владимирович - кандидат технических наук, ναπληρωτής Επικεφαλής Ιατρός Χειρουργικής

    Моисеенко Алексей Эдуардович - ναπληρωτής Επικεφαλής Ιατρός για CER, ουρολόγος-ανδρολόγος.

    Чагаева Тамара Султановна

    "СМ-Клиника" στο δρόμο. Лесная, д. 57, корп. 1

    Дзидзария Марина Игоревна - πικεφαλής Ιατρός, ατηγορία Ι νδοκρινολόγος, Διατροφολόγος, Ph.D.

    Σμύρνοβα Ναταλία Αντρέβνα - Αναπληρωτής Επικεφαλής Ιατρός Ιατρικών Υποθέσεων, ενδοσκοπικός.

    Александрова Екатерина Александровна - ναπληρωτής Επικεφαλής Ιατρός για Κλινική Εμπειρογνωμοσύνη, Ιατρός, Γαστρεντςρολ.

    οζάκοβα Νάντεζντα Ναρμάτοβνα - Αναπληρωτής επικεφαλής ιατρός για την εξυπηρέτηση πελατών.

    «СМ-Клиника» στο Старопетровский проезд, д. 7А, корп. 22

    Родионова Ольга Сергеевна - επικεφαλής ιατρός, μαιευτήρας-γυναικολόγος.

    Терпелова Елена Александровна - ναπληρωτής επικεφαλής ιατρός για κλινικές ειδικές εργασίες, καρδιολόγος, γενικός ιατρός.

    Σιρίνμπεκ Ολίμι - Αναπληρωτής Επικεφαλής Ιατρός Χειρουργικής, Χειρουργός, Φλεβολόμιο, ατπικ ατρκ

    Кибец Σεργκέι Ανατολίεβιτς - Αναπληρωτής επικεφαλής ιατρός για ιατρική εργασία, ουρολυαγηη

    Вихарева Елена Валентиновна - ναπληρωτής επικεφαλής ιατρός για τον πολυκλινικό, ογκολόγο-μαστολόγο

    Шатова Наталья Владимировна - Αναπληρωτής επικεφαλής ιατρός για την εξυπηρέτηση πελατών.

    "СМ-Клиника" στο δρόμο. Κλάρα Ζέτκιν, 33/28

    Малышева Наталья Валентиновна - επικεφαλής ιατρός, γενικός ιατρός, παθολόγος στην εργασία.

    Давыдов Владислав Георгиевич - Αναπληρωτής Επικεφαλής Ιατρός Χειρουργικής, Χειρουργός, Ph.D.

    Λεβάνοβιτς Τατιάνα Βαντίμοβνα - Αναπληρωτής Επικεφαλής Ιατρός CER, δερματοβενιολγο τηρκιηςγο τηροκκλθτροκ

    Беляева Ирина Игоревна - Αναπληρωτής Επικεφαλής Ιατρός για μια πολυκλινική.

    Γκριγκόρενκο Λιουτμίλα Αλεξέβνα - Αναπληρωτής επικεφαλής ιατρός για ιατρικό τμήμα, γ.Dενικός ι

    ινιάιτσεβα Λίλια Ολέγκοβνα

    «CM-Clinic» στο δρόμο. Ярославская, 4, συνεργ. 2

    Устинов Алексей - επικεφαλής ιατρός.

    Щепетов Георгий Игоревич - Αναπληρωτής Επικεφαλής Ιατρός.

    Старостин Иван Васильевич - ναπληρωτής επικεφαλής ιατρός για εξωτερικά ιατρεία, γενικός ιατρός, канд.

    Зазиева Виктория Евдокимовна

    Σίμακοφ Αλέξανδρος Ανατόλιεβιτς - επικεφαλής του χειρουργικοομ

    υρπίσοφ Άγκλαμ Μουράτμπεκοβιτς - Αναπληρωτής Επικεφαλής Ιατρός Χειρουργικής, ειρουργός, ειρουργός, ειρουργός,Д.

    Зубова Людмила Васильевна - Αναπληρωτής επικεφαλής ιατρός για το CED.

    Гагиева Мадина Руслановна - ναπληρωτής επικεφαλής ιατρός για την εξυπηρέτηση πελατών

    «CM-Clinic» στο δρόμο. Γιάρτσεβσκαγια, 8

    Запольский Александр Геннадьевич - Επικεφαλής Ιατρός, к.э.н., MBA.

    Γιούρικοφ Αλεξέι Σβιατοσλαβόβιτς

    Благовская Мария Альбертовна - ναπληρωτής Επικεφαλής Ιατρός Ιατρικών Υποθέσεων, ενδοκρινολόγος.

    Паслар Иван Иванович - Αναπληρωτής επικεφαλής ιατρός χειρουργικής, ουρολόγος-ανδρολόγος.

    Дулова Александра Владимировна - ναπληρωτής επικεφαλής ιατρός για το εξωτερικό ιατρείο, χειρουργός.

    Ковалева Ирина Михайловна - Αναπληρωτής επικεφαλής ιατρός για την εξυπηρέτηση πελατών.

    «СМ-Клиника» στην οδό Маршала Тимошенко, 29

    Нетруненко Ирина Юрьевна - πικεφαλής ιατρός, δερματοβιολόγος, к.Д.

    ποφ Αντρέι Βλαντιμίροβιτς - Αναπληρωτής Επικεφαλής Ιατρός.

    Галактионова Άννα Σεργκέεβνα

    Занибеков Мурат Магамедович - ναπληρωτής επικεφαλής ιατρός χειρουργικής, χειρουργός, φλεβολόγος.

    υρνέβα Όλγα ικολάεβνα - Αναπληρωτής επικεφαλής ιατρός για την εξυπηρέτηση πελατών.

    "СМ-Клиник" στην προοπτική Волгоградский, 42, κτίριο 12

    Терентьева Татьяна Александровна

    Чекрыгина Марина Вячеславовна - Αναπληρωτής Επικεφαλής Ιατρός, Δερματοβενιολόγος.

    Сниховский Станислав Иосифович - ναπληρωτής Επικεφαλής Ιατρός για Κλινική Εμπειρογνωμοσύνη, αρδιολόγος.

    Марченко Татьяна Михайловна - ναπληρωτής επικεφαλής ιατρός για εξωτερικούς ασθενείς, πνευμονολόγος, πνευμονολγο, αλλεργιγοτγοτγοτγογοτγογοτγοτγοτγοτγοτγοτγογοτγοκτγοτγοτγοτγογοτγοτγοτγοτγοτγοτγο.

    πικεφαλής του χειρουργικού τμήματος, χειρουργός, ενδοσκοπικός.

    Аракелян Μαρίνα Βίκτοροβνα - Αναπληρωτής επικεφαλής ιατρός για την εξυπηρέτηση πελατών.

    Воробьева Светлана Викторовна - διευθυντής θεραπευτικό τμήμα νοσοκομείο, αιματολόγος της υψηλότερηυ κατηγορίας, ματηγορίας.

    «СМ-Клиника» στο 2ο Сыромятнический ανά. 11

    Слободина Галина Александровна - επικεφαλής ιατρός, θεραπευτής της υψηλότερης κατηγορίας, ρευματολγος, канд.

    Σιρόκοβα αταλία Μιχαηλόβνα - ναπληρωτής επικεφαλής ιατρός για ιατρικό τμήμα, πνευμονογο.D.

    Γκόγκαγεβα Σβετλάνα Μπορισόβνα - Αναπληρωτής Επικεφαλής Ιατρός για λινική Εμπειρεβα Σβετλάνα πορισόβνα - ναπληρωτής Επικεφαλής Ιατρός για λινική Εμπειρρροτ, μπειρρροτ, μπειρρροτ, μπειρρροτ, μπειρροστ

    Горовой Александр Михайлович - πικεφαλής της κλινικής εξωτερικών ασθενών, οφθαλμολαρυγγολόγος, γιατρός κατηγορίας ΙΙ.

    Грушникова Виктория Васильевна - Αναπληρωτής επικεφαλής ιατρός για την εξυπηρέτηση πελατών.

    «СМ-Клиника» στη λεωφόρο Симферополь

    Чекмарева Евгения Леонидовна - επικεφαλής ιατρός, γενικός ιατρός.

    ασιλιέβα Ναταλία Σεργκέεβνα - Αναπληρωτής Επικεφαλής Ιατρός Ιατρικών Υπλοθέσεων, Γαρτοτο

    Львов Андрей Андреевич - ναπληρωτής επικεφαλής ιατρός για τον πολυκλινικό, χειαρουργό, κολοπροκτολόγο, γιατρΙ ιατρό.

    Каранашев Артур Адамович - ναπληρωτής Επικεφαλής Ιατρός Χειρουργικής, Ανδρολόγος, Ουρολόγος, Χειρουργός.

    ολχίνα Όλγα Στανισλαβόβνα - Αναπληρωτής Επικεφαλής Ιατρός για Κλινική Εμπειρογνωμοσύνκοροκορο.Д.

    Мирончикова Юлия Владимировна - Επικεφαλής του παιδιατρικού τμήματος, παιδίατρος.

    Карпенко (Исмаилова) αταλία Αντρέβνα - Αναπληρωτής επικεφαλής ιατρός για την εξυπηρέτηση πελατών.

    «СМ-Клиника» στο Солнечногорск στην οδό Красная

    Λαρίνα αρίνα Βλαδίσλαβοβνα - επικεφαλής ιατρός, γενικός ιατρός, γαστρεντερολόγος.

    Σαβονίνα Όλγα Αλεξέβνα

    Морошкин Игорь Игоревич

    Овчинников Ярослав Александрович - πικεφαλής του τμήματος εξωτερικών ασθενών.

    ναπληρωτής Επικεφαλής Ιατρός Εξυπηρέτησης Πελατών.

    «СМ-Клиника» στην πόλη Солнечногорский мкр. Ρεκίντσο

    Вячеслав Шадевский - επικεφαλής ιατρός, αλλεργιολόγος-ανοσολόγος της 1ης ιατρικής κατηγορίας.

    Σαβονίνα Όλγα Αλεξέβνα - Αναπληρωτής Επικεφαλής Ιατρός Ιατρικών Υποθέσεων, Καρδιολόγος.

    Морошкин Игорь Игоревич - ναπληρωτής Επικεφαλής Ιατρός για κλινικές εμπειρογνώμονες, νευρολόγοχ, γιατρός δικώνγο, γιατρός δικνγ.

    Стульба Сусанна Александровна - ναπληρωτής επικεφαλής ιατρός για την εξυπηρέτηση πελατών.

    Κλινική για παιδιά και εφήβους «CM-Doctor», 3ο εδάφιο Марьина Роща, 41

    Цатава Ия Амуровна - επικεφαλής ιατρός, παιδίατρος, υποψήφιος ιατρικών επιστημών.

    Ζιλίνα Έλενα Γκεοργκιέφνα - Αναπληρωτής Επικεφαλής Ιατρός για Κλινική Εμπειρογνωμοσύνη, Παιδίατρος, Παιδιατρικός Φυσιοθεραπευτής, Ιατρός Κατηγορίας Ι.

    Лихошерстова Όλγα Βίκτοροβνα - ναπληρωτής επικεφαλής ιατρός στο τμήμα εξωτερικών ασθενών, παιδίατρος.

    Лелюкевич Ирина Мечиславовна - Αναπληρωτής προϊστάμενος ιατρός για ιατρικές υποθέσεις, παιδίατρομεεισικμ, ειδικ γιοι

    Сейранова Изабелла Николаевна - ναπληρωτής επικεφαλής ιατρός χειρουργικής, παιδίατρος, παιδιατρικός ουρολόγος-ανγγολόγος-ανγο.

    Λούκιν Ιβάν Τζενάντιεβιτς - Επικεφαλής του χειρουργικού τμήματος του νοσοκομείου, νοσοκομείουαιιιτιτοροκογιοιτοροκοιιοροκοι, παιδορκοι, παιδροτογ

    Мозерова Елена Васильевна - Αναπληρωτής επικεφαλής ιατρός για την εξυπηρέτηση πελατών.

    λινική για παιδιά και εφήβους "CM-Doctor" στο δρόμο. Космонавта Волкова, 9/2

    Садовская Елена Геннадьевна - επικεφαλής ιατρός, παιδίατρος, αλλεργιολόγος και ανοσολόγος.

    Лосев Андрей Александрович - Αναπληρωτής Επικεφαλής Ιατρός για Κλινική Εμπειρογνωμοσύνη

    Αντόνοβα Ναταλία Βλαδίσλαβοβνα - Αναπληρωτής επικεφαλής ιατρός για την εξυπηρέτηση πελατών.

    ιλίνα Έλενα Γεωργίεβνα - Αναπληρωτής Επικεφαλής Ιατρός για Ιατρικά Θέματα.

    Горицкая Ольга Валентиновна - επικεφαλής νοσοκόμα.

    ντρο Κοσμετολογίας και Αισθητικής Ιατρικής «CM-Cosmetology»

    - Γενικός Διευθυντής της «СМ-Косметология».

    νκοβα Άννα Ρωμανόβνα - Διευθυντής Ανάπτυξης.

    Жуковская Оксана Владимировна - επικεφαλής ιατρός.

    ντριγιάνοβα Όλγα Αλεξέβνα - ναπληρωτής επικεφαλής ιατρός για το πολυκλινικό μέρος.

    αστσένκο κατερίνα Γιουριέφνα - Αναπληρωτής Επικεφαλής Ιατρός για Ιατρικά Θέματα.

    Александрова Лидия Геннадьевна - Αναπληρωτής επικεφαλής ιατρός για την εξυπηρέτηση πελατών.

    Рукавичкина Галина Николаевна - Διευθυντής ART στο σαλόνι ομορφιάς.

    Δίκτυο καταστημάτων "SM-Dentistry"

    Финогенова Ольга Вячеславовна - πικεφαλής, οδοντίατρος-θεραπευτής, ριστεία στην υγειονομική περίθαλωίπον ΡΟμδιοσπον ΡΟμδιοπον ΡΟμδιοπον ΡΟμδικ.

    Кржижановская Юлия Александровна - επικεφαλής ιατρός, οδοντίατρος-θεραπευτής, канд.

    νκοβα Άννα Ρωμανόβνα - Διευθυντής Ανάπτυξης.

    Γιορτσένκο Ναταλία Βίκτοροβνα - πικεφαλής του οδοντιατρικού τμήματος "SM-Clinic" στο δρόμο. Космонавт Волкова, οδοντίατρος-θεραπευτής, περιοδοντολόγος, канд.

    Иванова Оксана Олеговна - ναπληρωτής επικεφαλής ιατρός για την εξυπηρέτηση πελατών.

    Ростовенко Инна Ивановна - πικεφαλής του οδοντιατρικού τμήματος «СМ-Клиник» στο δρόμο.Ярославская, οδοντίατρος-θεραπευτής, χειρουργός.

    Чекменева Светлана Алексеевна - Επικεφαλής του οδοντιατρικού τμήματος της καλινικής για παιδιά και εφήβοτου.

    οπόβα Ναταλία Νικολάεβνα - Αναπληρωτής επικεφαλής ιατρός για την εξυπηρέτηση πελατών.

    πηρεσα ασθενοφόρων "Доктор 03"

    Ishmanov Закир Наилевич - Επικεφαλής γιατρός, γιατρός έκτακτης ανάγκης

    Ρατούνοβα Γιούλια Νικολάεβνα - Αναπληρωτής επικεφαλής ιατρός για την εξυπηρέτηση πελατών.

    Διευθυντής του Κλινικού Ιατρικού Κέντρου, Κρατικό Πανεπιστήμιο Ιατρικής και Οδοντιατρικής της A. I.σχ Евдокимова - Ακαδημαϊκός της Ρωσικής Ακαδημίας Επιστημών, Καθηγητής Βλαντιμίρ Βίκτοροβιτς Κρίλοφ , Επικεφαλής του Τμήματος Νευροχειρουργικής και Νευροαναισθησίας, МГМСУ, Επικεφαλής Νευροχειρουργού του Υπουργείου Υγείας της Ρωσικής Ομοσπονδίας.

    παγγελματική αναφορά

    Γεννήθηκε το 1957.

    ο 1981 αποφοίτησε από το Πρώτο Λένινγκραντ ιατρικό ινστιτούτο τους.акад. Ι.Ρ. Παύλοβα.
    πό το 1982 ρχισε να εργάζεται στο N.V. Ν.Β. Ο Склифосовский στην κλινική του δασκάλου του - Καθηγητής Вячеслав Васильевич Лебедев - πρώτα ως κατώτερος, στη συνέχειαυμγεαυερο στη συνχειαυμγεανκτκτκττκτττττ Το 1987 υπερασπίστηκε τη διατριβή του υποψηφίου του, το 1994 - τη διδακτορική του διατριβή με θέμα: "Πρώιμη χειρουργική θεραπεία ενδοκρανιακών αρτηριακών ανευρύσεων σε αγγειακό σπασμό και εγκεφαλική ισχαιμία."

    πό το 1994 - πικεφαλής του Τμήματος Νευροχειρουργικής Έκτακτης Ανάγκης στο Ν.Ν. Ν.Β. Склифосовский. Πό το 2003 г. εναι επίσης επικεφαλής του Τμήματος Νευροχειρουργικής και Νευροεπισκόπησης του Κρατικικικπησης του Κρατικικικπησης του Κρατικικικαυαυαυαιοανατονταποτανταιοτανταιατανιοασπονταιατανικο αποντατανιοαποικο, ατοητο, ατοητο, ατοητο, Πό το 2014 - Διευθυντής της Πανεπιστημιακής Κλινικής του M. G. ΟΛΑ ΣΥΜΠΕΡΙΛΑΜΒΑΝΟΝΤΑΙ. Ευδοκίμοβα.

    Το 2005 εξελέγη αντίστοιχο μέλος της Ρωσικής Ακαδημίας Ιατρικών Επιστημών, το 2011 πλήρες μέλος της Ρωσικής Ακαδημίας Ιατρικών Επιστημών, που ειδικεύεται στη νευροχειρουργική.
    πό το 2013 - καδημαϊκός της Ρωσικής Ακαδημίας Επιστημών.

    1996 έως 2010 В.В. Ο ρύλοφ ήταν ο επικεφαλής νευροχειρουργός του Υπουργείου Υγείας της Μόσχας.
    πό το 2014 - πικεφαλής Νευροχειρουργός του Υπουργείου Υγείας της Ρωσικής Ομοσπονδίας.
    πιστημονικός επιμελητής ομοσπονδιακά κέντρα νευροχειρουργική στο Тюмень και το Новосибирск.

    В.В. Ο Κρύλοφ και το προσωπικό του ανέπτυξαν και υλοποίησαν κρίσιμες πτυχές διάγνωση και θεραπεία διαφόρων μορφών οξεία διαταραχή εγκεφαλική κυκλοφορία, τραυματισμοί στον κρανιοεγκεφαλικό και νωτιαίο μυελό: χειρουργική τακτική σε ρήξη ανευρύσεων σε οξεία περίοδος ενδοκρανιακή αιμορραγία και οι αρχές της μικροχειρουργικής των ανευρύσεων, μέθοδοι διάγνωσης και χειρουργική θεραπεία σύνδρομο οξείας εξάρθρωσης σε τραυματικό εγκεφαλικό τραύμα και τραυματισμούς του οπίσθιου κρανιακού βρώμικου, ένα σύστημα για τη διάγνωση και τη θεραπεία των τραυμάτων κρανιοεγκεφαλικών τραυμάτων, αρχές διάγνωσης και χειρουργική επέμβαση για τραυματισμό του νωτιαίου μυελού, μέθοδοι πρόληψης και θεραπεία δευτερογενών επιπλοκών στην ενδοκρανιακή αιμορραγία (αγγειακή σπασμός, εγκεφαλική ισχαιμία, υδροκεφαλία, κ. λπ.), μέθοδοι ελάχιστα επεμβατικής χειρουργικής και τοπικής ινωδόλυσης για ενδοκρανιακές αιμορραγίες, μέθοδοι νευρικής πλοήγησης χωρίς πλαίσιο και ενδοσκόπηση βίντεο σε νευροχειρουργική έκτακτης ανάγκης, αρχές νευροπαρακολούθησης και εντατικής θεραπείας σε ασθενείς με οξεία νευροχειρουργική παθολογία, μεθόδους για την πρόληψη σηπτικών επιπλοκών. Αρκετές μελέτες έχουν αφιερωθεί στα προβλήματα της επαναγγείωσης στην εγκεφαλική ισχαιμία, στη χειρουργική επέμβαση ανθεκτικής στα φάρμακα επιληψίας και στην οργάνωση της νευροχειρουργικής φροντίδας.

    В.В. Ο Крылова είναι ο εμπνευστής και ο διοργανωτής των πρώτων κύριων τάξεων και των εκπαιδευτικών κύκλων στη Ρωσική Ομοσπονδία διάφορα προβλήματα έκτακτης ανάγκης νευροχειρουργική (χειρουργική επέμβαση και εντατική φροντίδα τραυματικών εγκεφαλικών βλαβών, νωτιαίων τραυματισμών, μικροχειρουργική εγκεφαλικών ανευρύσεων και θεραπεία αιμορραγικών εγκεφαλικών επεισοδίων), που πραγματοποιούνται ετησίως για νευροχειρουργούς και γιατρούς συναφών ειδικοτήτων από το 2002.

    В.В. Κρίλοφ - ρχισυντάκτης περιοδικό «Нейрохирургия» και μέλος του συντακτικού συμβουλίου του »Журнал нейрохирургии, выпуск.Ν. Бурденко »,« Περιοδικό Νευρολογίας και Ψυχιατρικής με το όνομα С.С. Корсаков "" Νευρολογικό περιοδικό "το περιοδικό της παγκόσμιας ένωσης νευροχειρουργών" Νευροχειρουργική «κ.λπ.

    В.В. Ο Крылов? μέλος του Προεδρείου της Επιτροπής Ανώτατης Βεβαίωσης της Ρωσικής Ομοσπονδίας, μέλος του συμβουλίου.Vατοβ Ερευνητικό Ινστιτούτο Νευροχειρουργικής Склифосовского акад.Ν.Ν. Μπουρντέκο.

    1995 και 1998 - Βραβείο του Δήμαρχου της Μόσχας στον τομέα της ιατρικής
    2003 - απονομή του Κρατικού Βραβείου της Ρωσικής Ομοσπονδίας για τον κύκλο εργασιών "Οξεία ενδοκρανιακή αιμορραγία: μελέτη της παθογένεσης και εισαγωγή νέων τεχνολογιών στη διάγνωση και τη χειρουργική θεραπεία"
    2004 - απονεμήθηκε ο τιμητικός τίτλος «Τιμημένος Επιστήμονας της Ρωσικής Ομοσπονδίας».
    2011 - απονομή του "Орден Почета"
    2013 - απονομή του βραβείου της κυβέρνησης της Ρωσικής Ομοσπονδίας για το έργο «Ανάπτυξη και εφαρμογή στην πράξη ενός συνόλου μεθόδων για ελάχιστα επεμβατική νευροχειρουργική για ασθένειες και τραυματισμούς νωτιαίος μυελός και τη σπονδυλική στήλη. "
    2014 - απονεμήθηκε ο τίτλος "Τιμημένος Υπεύθυνος Υγείας της Περιφέρειας Тюмень Calling "(2002 και 2007)
    Του απονεμήθηκε το Τάγμα του Νικολάι Πίρογκοφ της Ευρωπαϊκής Ακαδημίας Ιατρικών"
    Βραβευμένος με το πρώτο εθνικό βραβείο για τους καλύτερους γιατρούς της Ρωσίας.". Επιστημών, С. С. Юдин "Για υπηρεσίες ιατρικής έκτακτης ανάγκης", πιστοποιητικό τιμής του Υπουργείου Υγείας της Ρωσικής Ομοσπονδίας.
    Νικητής του βραβείου Владимир Высоцкий "Собственный Track" (2005).

    Пашкова Евгения Юрьевна - Лиеченье 2021

    ⚕️Пашкова Евгения Юрьевна - личник эндокринолог, искусство от 14 лет.Trošak prijema od 2500 rubalja. Sverecnzije o liječniku. Снимайте путь интернета или телефоном.

    Стручняк за лицевыми болезнями, различиями гиперандрогенемии у женщин, например, уставов претилостей и метаболических синдромов, остеопороза, диябетес, 1. и 2. Типа. Obavlja planiranje i upravljanje trudnoće i period nakon poroda u žena s različitim endokrini poremećaji (hipotiroidizam, Gravesovu bolest, dijabetes tip 1, pretilosti, hyperprolactinemic hipogonadizam). подробная информация о личнике

    Endokrinolog Pakočija Evejina Palača Povratne informacije

    Пашкова Евгения Юрьевна - эндокринолог, кандидат медицинских знаний, специализация эндокринология, гинекология.

    Евгения Юрьевна дипломирала я почту с Московской медицинской академии. И. М. Сеченов, тада клиничко добивались и дипломные студии у специализаций эндокринологии, объявила я више от 40 объявленных дней.

    Nakon diplome iz kliničkog staža na specijalizaciji "Obstetrika and ginekologija" na ruskom drľavnom medical sveučilištu. Пирогова и радио у Знанством центра за хирургию, гинекологию и перинатологию. В. И. Кулаков, а затем их у МОНИКИ. М.Ф. Владимирского.Ima veliko iskustvo u upravljanju trudnica s različitim endokrinih bolesti, liječenje pacijenata s poremećajima funkcije štitnjače uključujući pozadini antivirusne terapije sativa za za za diri.

    Evgenia Y. je vrlo pažljiv i ozbiljanstručnjak, često rješava nevjerojatno složene проблема и istovremeno može pronaći индивидуальный приступ svakom pacijentu. Uostalom, često uspjeh liječenja ovisi o tome koliko liječnik može uvjeriti pacijenta na potrebu da se poduzmu odreeni napori za dobivanje rezultata u liječenivotni, a ponekad promijennostavnostavní.С добром, интеллигентным и единым слатком лиечнику много я лакше.

    Пашкова Евгения Юрьевна

    Recenzije o liječniku

    Svi smo se dogovorili, pa ćemo lijepo proporučiti liječnika. Zato što je liječnik jako, mislim, suosjećajan! Prije svega, došli smo s mnogim medicinskim izvješćima s poviješću bolesti. Pažljivo je prišao problemu proučavanja svih izvadaka koje smo mu dali. Da bi se točno utvrdila dijagnoza, prodeno je pravilno ispitivanje. Лежник сам по себе показывает на свих странах! Mislim da je cijena apsolutno prihvatljiva za Stručnjaka ove razine! Откройте для себя все возможное, чтобы получить доступ к вашему радио.Mislim da se prijavim za njega, jer imam i zdravstvene проблема.

    Stručnjak je odabrao recnzije i iskustvo. Liječnik je vrlo štedljiv, vješti. Kaostručnjak vrlo разборчивый, по образу позорности на nijanse prilično velike. Atmosfera na Recepciji je mirna, bez neugodne tišine. Liječnik mi je propisao lijekove. Osjećaji Recepcije su dobri. Sada pijem lijekove koje mi je liječnik dodijelio, a nema radikalnih rezultata.

    Besprijekoran liječnik. Recepcija je bila izvrsna. Liječnik je vrlo prijateljski.Usporedim s другим liječnicima koji su puno vidjeli i to je jedini liječnik u mom sjećanju koji suosjećam sa mnom. Specijalist pokušava liječiti ne samo vidljive znakove bolesti, već i pronaći dublje izvore svog razvoja. Može se vidjeti da liječnik koristi svoje vještine kako bi dobio zadovoljavajući rezultat u liječenju bolesti. Nakon snimanja, imao sam nadu da se konačno oporavim. Znam da većina od nas želi bez istraživanja, a da ne dobije trodimenzionalnu sliku naše bolesti, da primimo sveobuhvatan tretman, ali to se ne dogaa.Sviđa mi se to da sam temeljito pregledan, da bez potvrde bolesti, meni nisu propisani nepotrebni lijekovi. Kasnije ću se promatrati s ovim liječnikom, jer mu mogu povjeriti svoje tijelo.

    Liječnik je potpuno zadovoljan. Unatoč činjenici da smo kasnili, bili smo srdačno pozdravljeni. Od svih liječnika koje smo posjetili, ovaj, koji je vrlo kompetentan svemu, ne dijeli se na dodatne usluge koje nisu potrebne. Sve u situaciji, sve je jasno, sve govori najmanji detalj, sve je jednostavan jezik.Ovo je prvi liječnik koji nije propustio simptome koji nas brinu. Svakako ćemo pogledati rezultate liječenja, ali već u ovom trenutku osjećamo da će sve biti sretno. Mi smo sami došli liječniku prema riječima prijatelja, a sad ćemo o njoj oduševiti.

    Пуно, когда время проводится с еврейской проблемой. Pričekali su dok nije bilo nemoguće ništa učiniti. Па, primijetili su tog liječnika i odlučili se okrenuti prema njemu. Па, sve je jasno da je profesionalni profesionalac. Primili smo strahovito više razumljivih informacija od očekivanog.Dakle, sve je bilo super, kompetentno, s plaćanjem, sve glasno. Otpad nije tražio. Privuklo se da je izbor bio naša.

    Пашкова Евгения Юрьевна

    Водитель Оджела за эндокринологию, эндокринолог, гинеколог, андролог

    Медицинское искусство 15 година Квалификацийская категория медицинских - Образование Медицинский факультетогультец Московский прв. И.М. Сеченова, диплом с почтением (2001 г.) Дипломы кандидата медицинских знаний

    Адрес твртке ГКБ им.ИП Боткин
    Москва, 2. Боткинский пр-д, 5, строение 22 Телефоны 8 (916) 634 82 48

    Навигация по записи

    Подршка и развой страна: Центр за информационными технологиями и гардеробы для одной службы с большим количеством предметов. Državne granične službe nazvano po SP Botkin DZM

    © 2008-2017 Spusti ih. ИП Боткин

    Пашкова Евгения Юрьевна

    У овом тренутку, записку направлен лиечнику!

    Одаберите других эндокринологов пописа.

    O liječniku

    Пашкова Евгения Юрьевна specijalizirana je za liječenje, dijagnozu bolesti i patologija endokrinogsustava. Професионально проводите лицевые болезни, прыщи, поремечаем менструального цикла, здоровые, лицевые остеопорозе и различных порезов метаболизма фосфора-кальция. Д-р Пашкова sustavno podiže razinu kvalifikacije na tečajevima specijalnosti.

    Bolje nego izliječiti

    Vodite brigu o sebi? Jučer je to samo moda, a danas je sastavni dio našeg života.Чак и државне поликлиника отвараю некэ "центр здоровья".

    Regionalna poliklinika sa svojim redovima, naravno, neće dodati zdravlje. Нет, у медицинскими центрами постое посебни программы различий цены и влияния.

    Za one koji su počeli ozbiljno razmišljati o njihovu dobrobit tijekom sljedećeg desetljeća, važno je razumjeti što je uključeno u punom osmotr- «chekap» globalnoj razini? Овай «Меднова», rekao je dr.sc. гинекологом-эндокринологом Евгением Юрьевичем Пашков, Москва клинический заповедник «у врту», ​​ты проводи такву современную жизнь.

    - За почтой, потребно е "проверити", ако сэ ви и ваши преци никада нисте жалили због лошег здравля. Нажалость, природа у тиелу поставила непроблематични развития самого до 40-45 года. Nakon toga počinju negativne dobne promjene u tijelu. Nažalost, nema gena za "dugovjecnost" kod ljudi, a ako se ništa ne napravi, do 60. godine svatko će imati programirano blijeđenje. Али тадж процесс можно - я требао би бити! utjecati. Сви су механизмы за познати.

    Samo vas naučiti kako živjeti

    Uzmi, primjerice, dobro proučavane kardiovaskularne bolesti.Čimbenici rizika - prehrana, stres, hipodinamija - doslovno su u svakome, a srčani udar, iako, netko zaobilazi. To određuju geni - i možemo ih pronaći unaprijed, uzimajući krv za analizu. Слично том, постоянный комплекс анкетиранья коди омогучую одолжение ризика од развя цирозе у присутствия вируса гепатита у тиелу, как би се утврдил много других опасностей.

    Nakon svih pregleda naš pacijent se vraća kući, nemajući paket Recepata za ljekarnu, ali dobro osmišljene sastanke. I to nije uvijek tablete, ponekad - samo preoruke za sliku, stil života, jer zdravlje utječe na različite čimbenike.

    Naši programi namijenjeni su osobi koja želi živjeti dugo i dobro. Бити старины и болесни - за то не занима, а ми се бавимо время.

    "Ja počnem živjeti - prelazim u mirovinu!"

    Kao što pokazuje iskustvo Europe i Japana, moguće je biti gotovo zdravo za 80 godina. Люди нису болесни не само због високог стандартная жизнь, вец и због тога што су сви, uključujući osiguravajuća društva, zainteresirani za medicinske preglede, uključeni suprograme zdravranstvenog.

    Naša suvremena medicina nije niža od Zapada. Osoba treba poduzeti jednostavni prvi korak - doći na ispit. Daljnje radnje već se brinu o nadležnom, kvalificiranom liječniku koji zna što, kako i kada pretražiti, te je sposoban tumačiti rezultate.

    Kada je vrijeme za odlazak liječniku?

    Этап I - Prijem primarni liječnik (pregled pacijenta, dimenzija visina, težina, indeks tjelesne mase), рецепция гинеколог (или уролог) pregledi (EKG, procjena ultrazvuk dišne ​​funkcije urin), кр.

    II ступань - пациент из лиечника коди прима лиек добива кончни заключак о станю здравля,
    утврена е диягноза, определена е дальйня тактика провоеня пациента.

    На превентивном посылке личнику и музыке и жене требуется размислить о четвртом дезет. Otprilike četrdeset godina počinju one "spriječene" bolesti.

    Dovoljno je proći profilaktički pregled svakih 12 mjeseci. Prema iskustvu vlastitih pacijenata, 365 dana bez проблема - izvrsna nagrada za nekoliko sati, koje jednom godišnje posjećuju naše udobne urede s pogledom na Остожье и Волхонку.

    Mnogi dolaze i mladi ljudi jer je «izvanredna» Inspekcija Donosi očite prednosti pred brak, dugoročno polaska (посебно у земли с скупых лиекова), и, наравно, у приручения за трудно.

    Mnogi vjeruju da ne mogu priuštiti ispting u medicinskim centrima, ali to nije slučaj. Наравно, на неким мьестима коя су уключена у "пакете" анкета неприступно скупе предмете. Međutim, u medicinskim centrima s poviješću možete se dobro osloniti na znanstveno standardizirane, europske или izraelske program u kojima je sve poviješću i ništa suvišno.

    Na primjer, prosječna anketa u našem centru košta 10 do 15 tisuća rubalja, što je mnogo jeftinije od police osiguranja, i zapravo liječi bolest kada je već počela.

    Stoga ne vrijedi štedjeti za buduće zdravlje. I - samo zbog ekonomije!

    Osim klasičnog istraživanja koja procjenjuje zdravlje općenito, postoje posebni programi koji su usmjereni na određeni pacijent. Za žene je ovo posbna procjena opstetrijskog i ginekološkog zdravlja, kao i testiranje raka namijenjenih ranom otkrivanju i brzom liječenju malignih tumora.

    За люди у доби под уветом анкете, узимучи у обзор ньихове особне «букета» од болести - у дубинскую студию кардиоваскулярног сустава, вреднованье дишног, пробавног, и так далеко. Kada nam pacijent dođe s već razvijenom kroničnom bolešću - dijabetesom, metaboličkim sindromom or problemima štitnjače, Stručnjak će odabrati pojedinači.

    Svi želimo učiniti nešto dobro za sebe. Али нетко би требуетсяо объяснит это точно. U idealu, kojemu naš kolektiv nastoji, a ne samo istraživanje i objašnjavanje, reći, podučavati, dati jasne upute i.потакнути трикове!

    Hepatološki centar "Klinika na vrtiću"

    U klinici примат эндокринолог, андролог, уролог, гастроэнтеролог, гинеколог, эндокринолог, гинеколог, ультразвуком лиечнику, zarazne specijalisternişterologia, психологический терапевт, медицинский терапевт, медицинский терапевт, медицинский врач Prosjek iskustva Stručnjaka je 22 godine. Личные услуги у обслуживания: гастроэнтерология, злокачественная гинекология, кардиология, дрогама и алкоголь, психиатрия, психотерапия и эндокринология.Također možete proći kroz dijagnostiku: ultrazvuk, funkcijsku dijagnostiku.

    Liječnici hepatičkog centra "Klinika na vrtiću"

    Recenzije o hepatološkom centru "Klinika na vrtu"

    Čini se da samo ok 30 godina i kakve srčane проблема может быть неправильной? Али сейчас су почели стали прекиди у срцу, глава се стально врти, врло неугодна и больна. Prijatelji su savjetovali da se obrate A. Karasevu i nisu bili u zabludi. Nisam se upoznala s takvom ljubaznom i suosjećajnom liječniku.Nakon sveobuhvatnog pregleda, uzimanja testova, kardiograma и ultrazvuka, liječnik je smirio i propisivao liječenje. Испада да имам kongenitalni пролапс митрального вентиляции я, на sreću, nije zastrašujuće. А. В. Карасев nije propisao skupi lijek, ali smo počeli liječiti jednostavnim Vitaminima i umirujućim lijekovima. Puno mu je zahvalan na pažnji i skrbi, njegovo liječenje mi je jako pomoglo. Sada samo savjetujem njega i sve svoje prijatelje. Vrlo sam zadovoljan, volio sam sve.

    Znaš, ovo je izvrstan liječnik, operirao me 2007.Година. Ovo je liječnik od Boga. Sada se moj muž tretira za njega, nisam ni tražio friendog liječnika, ali mu odmah dođe. Da, malo je razgovarao, ali na takvim profesionalcima zdravlje se održava. Ogroman zahvalan svima, savjetujem svima.

    Много хвала Елени Львовны. Na vrijeme je pomogla mojoj kćeri. Ona ima srce od zlata. Neka Bog dade svoje zdravlje i sve najbolje!

    Martazinova je najbolji perinatolog. Svi UZysts će moći mjeriti duljinu kostiju, ali ako Bog zabrani pitanje ozbiljne dijagnoze fetusa - то же самое njemu.Ima publikacije o intrauterini Definiciji Shershevsky-Turnerovog sindroma. Ukratko, ako vam je potrebanstručni ultrazvuk fetusa, sigurno se prijavite za Martazinova S.K.

    Izvrstan liječnik! Pomogla mi je puno! Stručna profesionalna i lijepa osoba. Чула много добре рецензие о свом раду и побринула се за ньено особо искуство.

    ginekolog

    комментариев

    Volio sam Zvyagintsev

    nekoć bila na 4, bila sam registrirana s njom, ali danas sam došla da je bila 8 godina

    Ja Pashkov trudnoća dovela, da sede ired сигурно иде у больнику испало яко добар разлог - любав позорность на себя, као и сви хвалили много ю.Али sve je tako sporo, zapisuješ neko vrijeme, i možeš doći do liječnika za sat или dva od svog time. Успуть, Наташа, ако сам добро схвато, то е у вашем локальном гинеколога - те врсте као и ньегов заплет.

    a ja ne volim to (((zabilježen je u tome kad student je (((imenovan je strašno, pa čak i darovi zatražio (((ali to je moje mišljenje

    PASHKOVA IRINA PETROVNA.Kabinet ne 402 ( griješim). Stvarno mi se svidjelo, ostavio sam je za Globu.

    Da, mnogi su je pohvalili, ali sa mnom su imali dosta pregrada.Ja nisam prevered bilo, za mene glavna stvar je da je sve dobro s bebom. a onda je opet počela na prvi screening smo poslali kasno, a onda sam postao vrlo plohsch muž doveo me k njoj, a ona nije ni izaći kroz sestra je rekao: „Loša pozvati hitnu pomoć”, nakon nakon štoje ja ни питао это я како. Па, у ред. после слэмка била е чинженица да е она моя лиэкови и витамины претплатио на слободном, али нисам знала е само запис видио. Nisam se zaklinjala i nisam joj rekla da sam je željela promijeniti.Само е тихо otišao у главу и питао мне да су се промиениле tijek doktora.Zaveduyuschaya pokušao razgovarati, htjela razgovarati s nama, ali sam odbio. и не жалим кап.))) Свиня ми се Пашков!

    Klinika profesora Kalinčenka

    Ocjena:

    Glavni liječnik:

    Kalinchenko Svetlana Yurievna

    Stručnjaci (17)

    Kraljica Olga Sergeevna

    Palkova Galina Borisovna Evgenía Alexander

    Palkova Galina Borisovna Evgenia22 Palkova Galina Borisovna Evgenia22

    Recenzije

    Neću savjetovati nikoga da ode s endokrinolozima s Gusakovim DA.Pogrešno dijagnosticirani, propisani гормоны koji su smanjili funkciju štitnjače kada je trebala biti podignuta suprotno. Kontinuirano usisavanje novca

    Дарья Александровна и врло пристоянь струняк, и то не говорим из прве руки. Третья мужа за музыку проблема и неплодность. Подготовка к уроку урологу Грекову Е.А. - так да су заедно проводили мужа за мьес дана, или выличили из мушке болести. Sada muž ne ide u kliniku, ali jednostavno kod kuće povećava testosteron kojeg propisuje Grekov EA.гонадотропин. Rekli su или rekli da će doći na ponovljeni spermogram u 3 mjeseca, ali ja kao žena već rezultat iz zajedničke referentne pile u 3 tjedna! Super liječnici.

    Bio sam zadovoljan liječenjem u klinici. Имам višegodišnji проблема, a tamo je bio (ne odmah, naravno, ali za dugi tečaj) pomogao. Šteta što free medicina u našoj zemlji znači "lijek je loš". Наравно, мало я чучало у овом малом иконику, али то я било вриедно! Elim spomenuti ginekologa Apetove, izvrsnog Stručnjaka.Я рекомендую е све очайно.

    Čudno je pročitati negativno o Gusakovu. Liječena je 6 godina (kada nije radila u ovoj klinici). Izvrstan liječnik! Моя щитовидку довела до норме с комплицираном диагнозом ТТЗ-а. Držim, živim i osjećam se dobro samo zahvaljujući ovoj terapiji.

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *