Псевдотуберкулез что это: причины, симптомы и лечение в статье инфекциониста Александров П. А.

Содержание

Псевдотуберкулез

Содержание:

Заболевание псевдотуберкулезом

Эпидемиология

Клинические проявления псевдотуберкулеза

Диагностика псевдотуберкулеза

Лечение туберкулеза

Профилактика псевдотуберкулеза

Как правило, острые кишечные заболевания возникают в жаркое время.Однако, псевдотуберкулез заявляет о себе именно в холодное время года, а максимальное число заболевших приходиться на апрель-май, что обусловлено рядом причин.

Псевдотуберкулез или дальневосточная скарлатиноподобная лихорадка (иногда так данную инфекцию описывают в литературе) — острое инфекционное заболевание, характеризующееся полиморфизмом клинических проявлений с преимущественным поражением желудочно-кишечного тракта, кожных покровов и опорно-двигательного аппарата.

Псевдотуберкулез широко распространен во всем мире, есть основание предполагать, что заболевание встречается значительно чаще, чем диагностируется.

Данный вид инфекции регистрируется в течение всего года, но выраженный сезонный подъем отмечается в зимне-весенние месяцы и поражает все возрастные группы. Но дети болеют значительно чаще, чем взрослые. У детей до года заболевание практически не встречается, что связано с характером питания.

Дети до трех лет болеют редко, а максимальный подъем заболеваемости приходится на 7-15 летний возраст. Псевдотуберкулезом болеет преимущественно городское население, реже — сельское (здесь играет роль способ сохранения овощей, т. к. чаще всего это домашние чистые и сухие погреба, куда доступ грызунам запрещен).

Эпидемиология

Основными носителями псевдотуберкулеза в природе являются мышевидные грызуны, а также зайцы. Возбудитель из организма грызунов попадает в почву и воду. С частицами почвы на корнеплодах возбудитель переносится в складские помещения, где находит оптимальные условия для своего накопления. Интенсивно он накапливается на овощах в овощехранилищах «примитивного» типа с существенными колебаниями температуры и влажности. Передача возбудителя человеку происходит либо непосредственно через сырые овощи, либо возбудитель псевдотуберкулеза попадает в готовую пищу через оборудование, инвентарь, посуду или загрязняется грызунами. Накопление возбудителя в готовых блюдах может происходить и при нарушениях технологии приготовления блюд, увеличении сроков их хранения.
От человека к человеку данный вид инфекции не передается. Заражение людей в основном возникает при употреблении сырых овощей, длительно хранившихся на овощных базах, или выращенных в теплицах, где происходит накопление бактерий. Факторами передачи в большинстве случаев являются сырые салаты, приготовленные с нарушением правил обработки овощей, и возникает чаще всего в организованных коллективах, объединенным общим пищеблоком.

Клинические проявления псевдотуберкулеза

Клиника данного заболевания столь разнообразна, что может протекать под маской таких инфекций как ОРВИ, скарлатина, корь, вирусный гепатит, острые кишечные инфекции, ревматизм (если суставная форма), аллергический дерматит. Труднее всего приходиться с атипичными или стертыми формами, т. к. из-за вовремя не назначенного специфического лечения выздоровление может затянуться, или заболевание перейдет в хроническое течение. В большинстве случаев (95%) заболевание начинается остро. Дети жалуются на слабость и головную боль, мышечные и суставные боли. Температура тела достигает фебрильных цифр — 38 С — 39 С, что нередко сопровождается ознобом. Также характерен катаральный синдром: покашливание, насморк, покраснение слизистой оболочки ротоглотки (маска ОРВИ или ГРИППА). Также одними из первых регистрируются изменения со стороны желудочно-кишечного тракта: у детей снижается аппетит, появляется тошнота, реже однократная рвота, жидкий стул 2-3-х кратный, язык обложен густым белым налетом.

Характерны и боли в животе, особенно в правой подвздошной области. Учитывая и повышение температуры, можно заподозрить острый аппендицит, и тогда такие пациенты попадают в хирургический стационар, где им проводят оперативное лечение, а при изучении удаленного appendixa — выявляются воспалительные изменения. Также у большинства больных увеличиваются размеры печени, но признаки гепатита выявляются лишь в единичных случаях. В первые три дня заболевания появляется сыпь, отмечается гиперемия кожи лица и шеи-симптом «капюшона», отечность и гиперемия стоп и ладоней – симптом «перчаток» и «носков». У части больных сыпь может носить «кореподобный» характер и сопровождаться зудом. Такая сыпь регистрируется чаще у детей младшего возраста и с отягощенным аллергическим анамнезом. Располагается сыпь вокруг суставов, на передне-боковых поверхностях туловища, голенях, реже в верхней части груди и шеи. После угасания сыпи появляется мелкое пластинчатое шелушение кожных покровов пальцев рук и ног. Как и при всех инфекционных заболеваниях различают 3 основные формы: легкую, среднюю и тяжелую. До 25% случаев отмечается волнообразное течение заболевания с обострениями и рецидивами. Хронические формы псевдотуберкулеза у детей встречаются крайне редко. Как правило, на фоне иммунодефицитных состояний.

Диагностика псевдотуберкулеза

Диагностика псевдотуберкулеза у детей основывается прежде всего на клинических и эпидемиологических данных. А вот точное лабораторное подтверждение диагноза удается получить спустя 7-15 дней (иногда до 4-х недель), в виду особенностей изменения иммунного ответа данным возбудителем инфекции.

Лечение туберкулеза

Лечение туберкулеза всегда проводится комплексно с учетом возраста ребенка, тяжести и периода заболевания, ведущего синдрома. Диета должна быть полноценной и соответствующей возрасту. А патогенетическая терапия направлена на устранение вызванных заболеванием изменений в органах и системах. Поэтому вопрос о продолжительности лечения, курсах а/б терапии, применении иммуномодуляторов всегда остается в компетенции врача. А из профилактических мероприятий на сегодняшний день остается несомненно единственным и важным: неукоснительное соблюдение комплекса санитарно-гигиенических норм хранения, технологии обработки и сроков реализации готовых продуктов, особенно овощных; борьба с грызунами. А в домашних условиях — тщательное мытье овощей, зелени и фруктов с удалением подгнивших и ослизненных участков.

Профилактика псевдотуберкулеза

Профилактика псевдотуберкулеза, как и многих других инфекционных болезней, заключается в соблюдении элементарных правил, позволяющих предупредить заражение возбудителями этих инфекций. Для предупреждения псевдотуберкулеза при использовании в пищу сырых овощей и корнеплодов их следует подвергать тщательной обработке. Необходимо промыть овощи в теплой воде, очистить ножом от остатков земли и вырезать все прогнившие, ослизненные и размягченные участки, потом снова промыть водой и ошпарить кипятком. Для разделки сырых овощей необходимо иметь специальный инвентарь.

Для приготовления салатов из сырых овощей допускается использовать овощи урожая предыдущего года только до марта. Сырые овощи и зелень, предназначенные для приготовления холодных закусок без последующей термической обработки, рекомендуется выдерживать в 3%-ом растворе уксусной кислоты или 10%-ном растворе поваренной соли в течение 10 минут с последующим ополаскиванием проточной водой.

ПСЕВДОТУБЕРКУЛЕЗ

Псевдотуберкулез- инфекционное заболевание, вызываемое Yersinia pseudotuberculosis, передающееся алиментарным путем и характеризующееся полиморфизмом клинических проявлений: интоксикацией, лихорадкой, поражением желудочно-кишечного тракта, кожи, опорно-двигательного аппарата и других органов. Псевдотуберкулезом заболевают все возрастные группы, но основная доля заболевших приходится на детей 3 — 6, 7 — 14 лет и подростков 15 — 17 лет. Для псевдотуберкулеза характерно удлинение сезонного подъема заболеваемости до летних месяцев, сроки которого зависят от времени завоза, хранения и реализации овощей населению. Основное значение в качестве факторов передачи при псевдотуберкулезе имеют продукты растительного происхождения (овощи, корнеплоды, зелень, фрукты), реже — вода открытых водоемов. Накопление возбудителя на овощах и корнеплодах с контаминацией тары, стен и пола происходит в овощехранилищах и складских помещениях организованных коллективов и предприятий общественного питания при нарушении температурно-влажностного режима и заселении инфицированными грызунами.

Резервуаром возбудителя псевдотуберкулеза являются мелкие дикие млекопитающие (полевки, мыши, песчанки, суслики, землеройки, бурозубки), а также синантропные грызуны (серые и черные крысы, домовые мыши). Эпидемиологическое значение в распространении возбудителя псевдотуберкулеза потенциально могут иметь насекомые: мухи, тараканы, муравьи как механические переносчики их возбудителей. Условием, способствующим заражению человека иерсиниями, является нарушение санитарно-эпидемиологического режима на пищеблоках организованных коллективов и предприятий общественного питания. Дезинфекционные мероприятия при иерсиниозах проводят на объектах, имеющих эпидемиологическое значение (категорийные объекты), к которым относятся организации: пищевого производства, осуществляющие хранение и торговлю продовольственными товарами, общественного питания, оздоровительные, образовательные, лечебно-профилактические и другие. Населению рекомендуется перед закладкой плодоовощной продукции и подсобных помещений теплиц обеспечить консервацию всех помещений, защиту их от насекомых и грызунов разрешенными для этого методами и средствами дезинфекции; тщательно мыть овощи и фрукты, проводить их термическую обработку перед употреблением в пищу.

У отравившихся в школе-интернате в Томской области детей обнаружили псевдотуберкулез — Сибирь

ТОМСК, 11 февраля. /ТАСС/. Врачи диагностировали псевдотуберкулез у отравившихся воспитанников школы-интерната Томской области, сообщил в четверг журналистам вице-губернатор области Иван Деев.

Ранее глава района Сергей Ревера сообщал ТАСС, что порядка 30 из 55 воспитанников школы-интерната получили пищевое отравление. Они были госпитализированы в состоянии средней и легкой степени тяжести.

«По Крыловке Бакчарского района: на самом деле это не вероятная вспышка, а действительно псевдотуберкулез, потому что выявлен возбудитель, это Yersinia pseudotuberculosis у этих пациентов», — сказал он. После инцидента власти региона провели проверку работы пищеблоков и овощехранилищ во всех учреждениях социальной защиты региона, учреждениях семьи и детей и образовательных учреждениях. Как отметил Деев, «были приняты меры», чтобы подобных ситуаций не возникало в будущем.

Как сообщила ТАСС начальник департамента общего образования Томской области Ирина Грабцевич, после инцидента в школе-интернате были проведены дезинфекция пищеблока, спальных корпусов, учебных корпусов, а также дератизация на пищеблоке и в овощехранилище. Кроме того, из рациона исключены салаты из сырых овощей. «В настоящий момент в школе находятся 20 учеников. Для них проводится учебный процесс в классах, питание организовано в столовой. По данному инциденту проводится расследование надзорными и правоохранительными органами. По итогам расследования будут приняты управленческие решения», — сказала она.

Как уточнили ТАСС в пресс-службе обладминистрации региона, на данный момент из больницы выписаны уже 12 детей.

По факту отравления проводятся проверки прокуратуры и областного СУ СК. Роспотребнадзор обнаружил в интернате очаг псевдотуберкулеза — там были найдены мыши-полевки. Заражение детей по первым итогам эпидрасследования произошло из-за неправильной обработки овощей, на которые попали выделения грызунов.

Псевдотуберкулез — острое инфекционное заболевание, которое вызывает один из представителей энтеробактерий рода Yersinia, поражает людей и животных. Эта кишечная инфекция возникает, например, при употреблении в пищу овощей и молочных продуктов без предварительной термической обработки. Характеризуется лихорадкой, интоксикацией, поражением тонкого кишечника, печени, нередко скарлатиноподобной сыпью.

РПГА с Yersinia pseudotuberculosis (Y. pseudotuberculosis IHA)

Интерпретация результатов

Интерпретация результатов исследований содержит информацию для лечащего врача и не является диагнозом. Информацию из этого раздела нельзя использовать для самодиагностики и самолечения. Точный диагноз ставит врач, используя как результаты данного обследования, так и нужную информацию из других источников: анамнеза, результатов других обследований и т.д.

Единицы измерения и коэффициенты пересчёта: тест полуколичественный. 

Результат предоставляется в форме «отрицательно» или «положительно» (в последнем случае с приведением титра – последнего разведения сыворотки дающего положительный результат). Диагностически достоверным считают прирост титров в 4 и более раз за 7-10 дней. 

Условно-диагностический титр – 1:100. При групповых вспышках псевдотуберкулёза для детей до 5 лет условно-диагностический титр может быть снижен до 1:50. 

Референсные значения: отрицательно. 

Интерпретация результата 

Положительно:

  1. текущая или перенесённая в прошлом инфекция. Рекомендовано обследовать больного не менее 2 раз – в начале заболевания и с интервалом в 7-10 дней, диагностически достоверным считают 4-кратный и более прирост титров антител. При необходимости оценивать одиночные результаты или отсутствии выраженной динамики титров допустимо использовать минимальный условно-диагностический титр 1:100. При групповых вспышках псевдотуберкулёза для детей до 5 лет условно диагностический титр может быть снижен до 1:50. Результат следует оценивать в комплексе с эпидобстановкой, формой и сроками болезни;
  2. редко — перекрёстные реакции (другие виды Yersinia,Vibrio, Salmonella, Brucella, Rickettsia).

Отрицательно:

  1. отсутствие инфекции данным сероваром Yersinia pseudotuberculosis;
  2. низкая концентрация или отсутствие антител в ранний период инфекции.

Иерсиниоз (псевдотуберкулез) | МЦ Здоровья

Псевдотуберкулез приходит с холодами!
Одновременно с наступлением холодов в дома сельских жителей начинают подселяются на зимовку грызуны с полей. Это чревато увеличением количества случаев заболевания иерсинеозом.
Трудности при диагностике иерсиниоза (псевдотуберкулез) возникают в связи с разнообразием клинических симптомов. В случаях поражения печени (гепатита) как ведущего процесса диагноз иерсиниоза ставится крайне редко.

Для иерсиниозного гепатита характерно:

— острое начало заболевания с лихорадки до 38-39 °С
— симптомы интоксикации: вялость, слабость, ухудшения аппетита
— боли в животе: увеличение размеров печени с болью в правом подреберье и эпигастральной области.


— желтуха появляется на 4-6-й день болезни, реже — на 2-й неделе от начата заболевания
— почти в половине случаев одновременно регистрируется скарлатиноподобная сыпь на коже с последующим шелушением.
— практически у всех больных пальпируется несколько групп лимфатических узлов (преимущественно передние и задние шейные, подчелюстные, подмышечные, паховые).
Как видно из перечня симптомов, заболевание очень похоже на «кишечный» грипп, сальмонеллез и другие кишечные инфекции. Возбудителем заболевания являются споронеобразующие палочки рода Yersinia. Палочки довольно неприхотливы, и могут размножаться в широком диапазоне температур, однако очень чувствительны к ультрафиолету, высыханию и выпариванию.
Основными резервуарами для развития возбудителя являются организмы млекопитающих животных: крупного рогатого скота, мышей, собак. Грызуны очень легко инфицируются палочкой рода Yersinia и в процессе жизнедеятельности распространяют инфекцию через свои фекалии, заражая воду или почву.
Основной способ передачи инфекции – фекально-оральный, через пищу. Рецидивы и обострения иерсиниоза возникают с частотой до 55%. Причем в 10% случаев болезнь переходит в подострую и хроническую форму. Что касается осложнений, то они многочисленны. В частности заболевание может дать осложнение в форме миокардита, холецистита, гепатита, панкреатита, аппендицита, перитонита, артрита и др. Исходы течения иерсиниозов, как правило, благоприятны, но септический вариант в половине случаев приводит к смерти пациентов.
Для диагностики заболевания необходимо как можно раньше обратиться к врачу. Материалом для лабораторных исследований на иерсиниоз может служить кровь, моча, кал или соскоб материала с зева.
Больным показана диета, лечение антибиотиками и симптоматическое лечение.

Как уберечься от псевдотуберкулёза | ЗДОРОВЬЕ

Ещё в начале прошлого века эта загадочная инфекция считалась редкой и очень тяжёлой, почти всегда приводящей к смерти больного. А на вскрытии экспериментально заражённых животных обнаруживались специфические образования, очень похожие на… туберкулёзные.

Микробный детектив

Об опасной кишечной инфекции, гуляющей по северным регионам страны, рассказывает исполняющая обязанности заведующей инфекционным отделением Центра СПИД врач-инфекционист Наталья Фокина.

Татьяна Боева, kamchatka.aif.ru: Наталья, что такое псевдотуберкулёз?

Наталья Фокина: Псевдотуберкулёз — острая инфекционная болезнь, вызываемая бактерией из рода иерсиний. В переводе на русский язык приставка «псевдо» означает «ложный». История открытия микроба, внешне похожего на чумную палочку, но вызывающего внутренние изменения, схожие с туберкулёзными, поистине детективная.

Новый микроорганизм был открыт в 1883 году. При гистологическом исследовании бугорков на лимфоузлах и внутренних органах погибших от инфекции животных выяснилось, что никакого отношения к известной палочке Коха, вызывающей туберкулёз, новый микроб не имеет.

Есть и ещё одна странность. Каждый просвещённый человек знает: большинство кишечных инфекций распространяются в жаркое время года. Но возбудителю заболевания, маскирующегося под старинную чахотку, для размножения необходимо пройти этап развития при пониженной температуре.

В нашей стране первая крупная вспышка псевдотуберкулёза была зарегистрирована в 1959 году во Владивостоке, когда от инфекции пострадало около 300 военнослужащих в результате употребления творога. Заболевание протекало с лихорадкой, поражением суставов и скарлатиноподобной сыпью и получило название дальневосточной скарлатиноподобной лихорадки. Окончательный вывод о псевдотуберкулёзной природе болезни был получен лишь в 1966 году, после опытов самозаражения русского врача Знаменского.

Дальнейшие эпидемиологические наблюдения показали, что вспышки заболевания происходили после употребления в пищу инфицированных псевдотуберкулёзными микробами пищевых продуктов, которые длительное время хранились при низких температурах в условиях холодильника.

По данным Всемирной организации здравоохранения, псевдотуберкулёз регистрируется более чем в 30 странах мира, чаще там, где прохладный климат и повышенная влажность. По распространённости среди острых кишечных инфекций в России иерсиниоз занимает второе место после сальмонеллёза. Ежегодно в стране регистрируется 4—5 тысяч случаев заболевания иерсиниозами, из них более 50 % — дети до 14 лет. В 2014 году заболеваемость псевдотуберкулёзом в Камчатском крае снизилась на 59 % по сравнению с 2013 годом. Но в марте 2015-го с псевдотуберкулёзной инфекцией были госпитализированы 20 учащихся из Милькова, которые поели салат в школьной столовой. Выяснилось, что инфекцию в овощехранилище занесли мыши. Была проведена дератизация. Все дети благополучно выздоровели.

С тех пор болезнь и получила название псевдотуберкулёза.

В настоящее время это одно из распространённых инфекционных кишечных заболеваний в России.

Чумовые родственники

– Кто же этот загадочный возбудитель ложно-туберкулёзной инфекции и как она проявляется?

– Возбудитель инфекции — родственная чумной палочке бактерия из рода иерсиний — широко распространён в природе, в почве и воде. Его особенность — в способности размножаться при температуре +4…+8 °С, то есть в условиях бытового холодильника. Именно поэтому заболевание иногда называют королевой холодильников.

Болезнь, вызванная данным микроорганизмом, характеризуется многообразием клинических симптомов, преимущественным поражением желудочно-кишечного тракта, печени и опорно-двигательного аппарата.

Псевдотуберкулёз может сопровождаться проявлениями, сходными с аналогичными признаками многих других заболеваний, не только инфекционных, но терапевтических и даже хирургических.

– Но какие-то типичные признаки всё-таки есть?

– Для типичного течения псевдотуберкулёза характерны кожные проявления — так называемые экзантемы, или сыпь, сгущающаяся в области шеи, кистей и стоп, то есть симптом «капюшона, перчаток и носков». Высыпания могут появиться и внизу живота, в подмышечной области, на боковых поверхностях туловища. Вскоре сыпь проходит, а на её месте наблюдается шелушение кожи. Увеличиваются печень и селезёнка.

Частые симптомы — боль в животе, суставные и мышечные боли, желтушный синдром, всё это может сочетаться, возможен и септический вариант с общим заражением организма.

Характерно острое начало заболевания, быстрый подъём температуры тела до 38—40 °С, явления общей интоксикации, тошнота, рвота, частый жидкий стул. Может отмечаться катаральный синдром — покраснение и боль в горле, покашливание, насморк, покраснение глаз.

– Насколько устойчив микроб во внешней среде и как передаётся заболевание?

– Бактерии псевдотуберкулёза неустойчивы к высокой температуре: кипячение приводит к их гибели в течение нескольких секунд. При нагревании до 60—80 °С микробы погибают через 15—20 минут. Иерсинии не выдерживают высыхания и солнечных лучей. Растворы дезинфицирующих веществ в обычных концентрациях убивают микробы в течение нескольких минут.

Отсюда понятно, что избежать заражения достаточно легко.

Между тем ежегодно заболевания псевдотуберкулёзом регистрируются в марте — июне и в осенне-зимнее время. Главный механизм передачи — фекально-оральный. Пути — пищевой и водный. Основные факторы передачи — употребление в пищу в сыром виде (без термической обработки) или некачественно обработанных овощей и фруктов, загрязнённых патогенными микроорганизмами, реже — вода и молочные продукты. Возможно заражение воздушно-пылевым путём при сухой уборке помещения.

От больного человека к здоровому болезнь не передаётся.

Ведущее эпидемиологическое значение в качестве источника инфекции для человека имеют грызуны: полевые и домашние мыши и крысы, которые своими экскрементами загрязняют овощи и фрукты в овощехранилищах, погребах, гаражах, дачах и сараях. При этом внешний вид и вкусовые качества загрязнённых бактериями овощей и фруктов не изменяются!

Свежая зараза

– Какова самая частая причина заболевания?

– Чаще всего заражение происходит при употреблении овощных салатов из свежей капусты, моркови, репчатого и зелёного лука. Также одним из самых благоприятных пищевых субстратов для размножения возбудителя считаются молочные продукты.

На свежей капусте, моркови, яблоках, репчатом луке микробы сохраняются в течение двух месяцев, в квашеной капусте — 3 суток, на свежих огурцах, редисе — до 22 дней.

– Насколько сложно вылечить псевдотуберкулёз и какова его профилактика?

– Лечение комплексное, с учётом тяжести заболевания, периода болезни и ведущих синдромов. Госпитализации в специализированные отделения или боксы инфекционных стационаров подлежат больные среднетяжёлыми и тяжёлыми формами заболевания. Своевременное обращение к врачу и полноценное лечение предупреждают длительное течение заболевания.

Специфическая профилактика до настоящего времени не разработана. После перенесённого заболевания иммунитет кратковременный.

Чтобы не допустить заражения, достаточно ряд простых правил при употреблении и приготовлении пищи. Особенно это касается овощей и фруктов, которые вы употребляете в свежем виде.

Например, собираясь делать салат из капусты, верхние 5-6 листов кочана нужно снять, их можно использовать только для супов и тушения.

Освобождённый от верхних листьев кочан капусты, а также очищенные от кожуры овощи и фрукты перед шинкованием на салат или употреблением в сыром виде необходимо тщательно промыть под проточной водой, а затем ошпарить кипятком или замочить на несколько минут в 3-процентном растворе уксусной кислоты.

Важны и условия хранения приготовленных салатов: в холодильнике их можно оставить не более чем на шесть часов, причём в не заправленном виде. Заправлять салат из свежих овощей и фруктов растительным маслом, майонезом или другим соусом нужно непосредственно перед употреблением в пищу, чтобы не усилить возможного размножения микробов. Для предупреждения заражения необходимо содержать холодильник в чистоте, а сырые овощи и фрукты держать в отдельных полиэтиленовых пакетах на специально выделенной полке.

И ещё один очень важный момент: никогда не покупайте молочные продукты на обочинах дорог, где они часами стоят на солнце в таре неизвестного происхождения. Молоко и продукты из него — самая лучшая питательная среда для любых кишечных микробов. Если вы всё же покупаете сырое молоко, его нужно обязательно кипятить!

И последнее. В домах, как в частных, так и многоквартирных, нужно вовремя проводить дератизацию, то есть уничтожать мышей и крыс.

В большинстве случаев прогноз заболевания псевдотуберкулёзом благоприятный. Но запускать болезнь нельзя! Без квалифицированной помощи и лечения возможно тяжёлое течение болезни с угрозой жизни больного. Не занимайтесь самолечением! Если вы заболели, обращайтесь к специалистам!

 

Псевдотуберкулез — признаки, причины, симптомы, лечение и профилактика

Диагностика

Диагностируется у пациента данное заболевание на основе клинических и лабораторных данных, а также эпидемиологического анамнеза.

Для того чтобы диагностировать у больного наличие псевдотуберкулеза, врач-терапевт проводит специальные исследования посредством бактериологической и серологической методики (четырехкратное повышение антител в крови за две недели).

Бактериологические исследования проводятся на основе испражнений, крови, посевов кала и мочи, рвотных масс, желчи, цереброспинальной жидкости, исследований лимфатических узлов и червеобразного отростка.

Больному также назначается сделать иммуноферментный анализ (ИФА), чтобы констатировать наличие псевдотуберкулезных антигенов у него в фекалиях.

При экспресс-диагностике псевдотуберкулеза назначаются РНГА с иммуноглобулиновыми диагностикумами и BФА. Кроме этого, пациент проходит и исследование биоптатов лимфатических узлов.

Лечение

Псевдотуберкулез лечат с помощью антибиотиков, сульфаниламидов и химиопрепаратов. Применяется также этиотропная антибактериальная терапия.

Длительность лечения во многом обусловлена формой и типом болезни. Если это локализованная форма псевдотуберкулеза, лечение занимает 7-10 дней. Если генерализованная – лечение будет продолжаться 12-14 дней.

Во время лечения псевдотуберкулеза врач-инфекционист назначает больному следующие средства:

  • дезинтоксикационные;
  • общеукрепляющие;
  • стимулирующие;
  • десенсибилизирующие.

При лечение псевдотуберкулеза также возможно предписание глюкозо-электролитных и полиионных растворов с целью регидратации. Больному назначается на время лечения диетическое питание – «стол четыре».

Профилактика

Основные профилактические меры против возникновения псевдотуберкулеза:

  • контролирование состояния овощехранилищ;
  • борьба с грызунами;
  • проведение санитарно-гигиенических мероприятий на пищевых предприятиях и пищеблоках;
  • соблюдение правил транспортировки, хранения, приготовления и реализации пищевых продуктов;
  • регулярный санитарный контроль за водоснабжением.

Литература и источники

  • Туманский В. М. Псевдотуберкулёз / Проф. В. М. Туманский. — М.: Медгиз, 1952. 
  • Туманский В. М. Псевдотуберкулёз. — 2-е изд. — М.: Медгиз, 1958.
  • Сомов Г. П., Покровский В. И., Беседнова Н. Н. Псевдотуберкулёз / Рец.: В. Ю. Литвин; АМН СССР. — М.: Медицина, 1990. 
  • Видео по теме:

    Yersinia pseudotuberculosis — Инфекционные заболевания и противомикробные агенты

    Yersinia pseudotuberculosis  вызывает зоонозную кишечную инфекцию у сельскохозяйственных животных, диких животных и птиц. Люди заражаются им при употреблении пищи или воды, загрязненных фекалиями животных. Обычно он вызывает легкие, самокупирующиеся заболевания брыжеечного аденита, илеита и диареи, но может вызывать серьезный сепсис и абсцессы у людей с ослабленным иммунитетом. Эта инфекция встречается реже, чем инфекция, вызванная двумя другими возбудителями Yersinia Y.pestis  и  Y. enterocolitica . В последнее десятилетие ее геном был выяснен благодаря интересу к этой бактерии как к предку чумной палочки Y. pestis , с которой у нее более 90% общих генов (1).

    МИКРОБИОЛОГИЯ

    Характеристики

    Y. pseudotuberculosis  это грамотрицательная палочка и факультативный анаэроб из семейства Enterobacteriaceae.Он оксидазоотрицательный, не ферментирует лактозу, уреазоположительный, цитратотрицательный и подвижен при выращивании при 25 0 C, но не подвижен при выращивании при 37 0 C. Оптимальная скорость роста при 30 0 C, и он будет расти в забуференном солевом растворе при 4 0 C. Было идентифицировано шесть серотипов (I-VI) и четыре подтипа, при этом на O-группу I приходится примерно 80% случаев заболевания человека. Он продуцирует липополисахаридный (ЛПС) эндотоксин с О-антигенной боковой цепью, который обладает биологической активностью, сходной с активностью других грамотрицательных бактерий.

    Генетика вирулентности

    Y. pseudotuberculosis  несет ту же вирулентную плазмиду размером 70 т.п.н., что и другие патогенные штаммы Yersiniae, pYV, которая кодирует систему секреции типа III (TTSS), иерсиниальные наружные белки (Yops) и антиген V, которые продуцируются в культуре при 37 0 C в ограничивающих рост условиях низких концентраций кальция. TTSS использует игольчатую инъекционную сому для введения Yops в клетки-хозяева.Основные эффекты Yops, которые представляют собой различные ферменты, активаторы ферментов и цитотоксины, заключаются в ингибировании фагоцитоза путем подавления цитокинов и вызывании апоптоза макрофагов (9). Мутанты Y. pseudotuberculosis , дефицитные по YopE и YopH у мышей, могли колонизировать кишечник и пейеровы бляшки, но не достигали селезенки и печени (16). Другие мутанты, дефицитные по Yops и TTSS, не выживали в кишечнике мышей после орогастральной инокуляции (17). YadA представляет собой молекулу адгезии, кодируемую плазмидой pYV, которая необходима для выживания и репликации в пейеровых бляшках.С другой стороны, сообщалось о двух пациентах, у которых в культурах были обнаружены pYV-негативные бактерии (27). Хромосомные гены, которые также необходимы для вирулентности, включают ген инвазина, который способствует проникновению бактерий в М-клетки, которые покрывают пейеровы бляшки (9). Мутанты с генами, дефектными для синтеза O-антигена в LPS, передающих бактерии с грубой морфологией колоний, приводят к тому, что организмы неспособны выживать в кишечнике мышей, а также неспособны проникать в эпителиальные клетки (17). Было показано, что цитотоксический некротизирующий фактор (CNF) секретируется растущими бактериями и может воздействовать на ГТФазы клетки-хозяина (15). Кроме того, суперантигенный токсин YPMa, также называемый митогеном Y. pseudotuberculosis , присутствует в 20% европейских изолятов и обладает активностью при внутривенном заражении мышей, ускоряющей смертность (3).

    ЭПИДЕМИОЛОГИЯ

    Зоонозная инфекция, Y. pseudotuberculosis , естественными резервуарами являются сельскохозяйственные животные, дикие грызуны, кролики, олени и птицы, включая индеек, уток, гусей, голубей, фазанов и канареек.Передается среди животных фекально-оральным путем. Люди заражаются при употреблении в пищу свежих продуктов, загрязненных фекалиями животных, зараженного мяса, особенно свинины, а также непастеризованного молока или зараженной воды. Инфекция встречается во всем мире, но большинство случаев было зарегистрировано во Франции и Скандинавии. О вспышках пищевого происхождения, связанных с употреблением тертой моркови и салата айсберг, сообщалось из Финляндии (11, 23). Во время вспышек, связанных с морковью, продукты хранились в открытых контейнерах в течение зимних месяцев, что обеспечивало доступ грызунов, а также естественное охлаждение, а морковь не мыли перед натиранием на терке для употребления в сыром виде (10, 20).Во время этих вспышек у более чем 500 школьников развилась лихорадка и боли в животе, а 5 подверглись ненужной аппендэктомии. Инкубационный период составлял от 4 до 18 дней, в среднем 8 дней. Прием пищи вне дома был фактором риска заражения в Финляндии (11). В исследовании финских свиней бактерии были выделены из 17% образца из 364 животных, при этом больше инфекций было обнаружено у свиней, выращенных на органических фермах и на фермах с более чем 1000 свиней (14). Свиньи, несущие эту инфекцию, не проявляют признаков болезни.Миндалины диких кабанов в Швеции содержали микроорганизм примерно у 20% животных (21). Миндалины забитых свиней из бельгийских ферм содержали его у 2-10% животных (24). Установлено, что это серьезная причина смерти коз в Калифорнии (6).

    КЛИНИЧЕСКИЕ ПРОЯВЛЕНИЯ

    Наиболее частыми проявлениями являются лихорадка и боль или спазмы в животе (2). Около половины пациентов испытывают боли в спине, а у четверти пациентов наблюдается рвота или диарея.Боль в животе часто локализуется в правом нижнем квадранте, что соответствует клинической картине дистального илеита и регионарного лимфаденита, что дает основание для диагностического наименования «псевдоаппендицит». Этот диагноз в некоторых случаях приводит к аппендэктомии, но УЗИ и КТ могут правильно выявить илеит и мезентериальный лимфаденит (27). Хотя в аппендэктомии нет необходимости, сообщается, что Y. pseudotuberculosis вызывает редкую форму заболевания, называемую гранулематозным аппендицитом (13).Другой особенностью этой инфекции, встречающейся у половины пациентов, является узловатая эритема, которая обычно следует за появлением абдоминальных симптомов примерно через 10 дней (10). Узловатая эритема представляет собой постинфекционную иммунологическую реакцию, которая возникает в основном у детей (25). Точно так же реактивный артрит развивается у четверти пациентов и более вероятен у взрослых с аллелем главного комплекса гистосовместимости HLA-B27 (25).

    Инфекция может распространяться из брюшной полости током крови, особенно у лиц с ослабленным иммунитетом, вызывая септицемию, абсцессы печени или селезенки, остеомиелит и септический артрит.В отчете о 27 случаях во Франции в 2004-2005 гг. у 22 человек бактерии были выделены из крови, а у 5 — из фекалий (26). Иммунодефицит присутствовал в 17 из этих случаев, включая сахарный диабет, рак, ВИЧ-инфекцию, цирроз печени и трансплантацию почки. Шесть из них погибли. Другие зарегистрированные случаи септицемии также включали пациентов с инсулиннезависимым сахарным диабетом и ВИЧ-инфекцией (5, 18, 19).

    Болезнь Кавасаки, самокупирующийся фебрильный васкулит у детей раннего возраста, как полагают, в некоторых случаях вызывается Y.псевдотуберкулез . В серии из 452 случаев в Японии у 42 детей с положительными посевами кала или повышенными титрами антител с большей вероятностью проявлялись потенциально серьезные последствия дилатации коронарных артерий и аневризм (22).

    ЛАБОРАТОРНАЯ ДИАГНОСТИКА

    Д . pseudotuberculosis  можно идентифицировать в культурах по его признакам грамотрицательной палочки, которая является лактозо-отрицательной, оксидазо-отрицательной и уреазо-положительной.Он отличается от других кишечных патогенов дальнейшими химическими реакциями: отрицательными для Фогеса-Проскауэра, цитрата, фенилаланиндезаминазы, орнитиндекарбоксилазы, ферментации сахарозы и целлобиозы, но положительными для ферментации рамнозы и мелибиозы. В культурах кала рост на агаре MacConkey или SS приведет к образованию очень маленьких колоний через 24 часа при 37 0 C, но колонии будут видны через 48 часов. Извлечение из образцов стула или загрязненных образцов окружающей среды может быть увеличено за счет использования селективных сред.Одним из них является CIN (цефсулодин-иргасан-новобиоцин) агар, который содержит антибиотики, к которым бактерии устойчивы. Образцы для культивирования также можно обогащать холодом, помещая их в фосфатно-буферный бульон и инкубируя при 4 0 C в течение 7 или 14 дней (14). ПЦР в реальном времени – это альтернативный метод диагностики инфекции в пищевых продуктах (12, 21).

    ПАТОГЕНЕЗ

    Организмы попадают в организм с зараженными пищевыми продуктами, такими как салаты, содержащие морковь или листья салата, свинину или воду.В течение инкубационного периода, который в среднем составляет 8 дней, бактерии достигают терминального отдела подвздошной кишки и проксимального отдела толстой кишки, где они проникают через эпителиальные клетки, покрывающие связанные с кишечником лимфоидные ткани, включая пейеровы бляшки. В качестве внутриклеточной инфекции бактерии поглощаются макрофагами, где они выживают и размножаются. С помощью TTSS и Yops Y. pseudotuberculosis ингибирует фагоцитоз, открывая микроорганизмам больший доступ к брыжеечным лимфатическим узлам и кровотоку. Результатами этой инфекции являются изъязвления слизистой в терминальном отделе подвздошной кишки, реже изъязвления в восходящей ободочной кишке, некротические поражения в пейеровых бляшках и увеличение мезентериальных лимфатических узлов. Прогноз для пациентов с мезентериальным лимфаденитом и илеитом благоприятен для выздоровления от самокупирующейся инфекции практически у всех ранее здоровых людей, но у пациентов с септицемией, которые часто имеют сопутствующие иммунодефицитные заболевания, примерно в 27% случаев отмечается летальный исход. несмотря на антимикробную терапию в больнице (26). Хотя острый аппендицит не вызывается Yersinae , случаи гранулематозного аппендицита приписываются Y.pseudotuberculosis , как показано при применении ПЦР-зондов к операционным образцам (13). В этих тканях были обнаружены эпителиоидные гранулемы, трансмуральные лимфоидные агрегаты, гигантские клетки, изъязвления слизистой оболочки, криптит, ассоциированное поражение лимфатических узлов и отсутствие микроабсцессов в большинстве случаев. Хотя Y. pseudotuberculosis не является причиной болезни Крона, за небольшим процентом острых инфекций последовали хронические симптомы, которые привели к диагнозу болезни Крона. Кроме того, у пациентов с болезнью Крона нарушен слизистый барьер, что может предрасполагать к иерсиниозу (8).

    РЕЗУЛЬТАТИВНОСТЬ IN VITRO И IN VIVO

    Изоляты Y. pseudotuberculosis продемонстрировали чувствительность к ампициллину, цефалоспоринам, тетрациклину, триметоприму-сульфаметоксазолу, хлорамфениколу, фторхинолонам и аминогликозидам. Организм устойчив к колистину. Будучи полностью чувствительным к ампициллину и цефалоспоринам первого поколения, он отличается от Y. enterocolitica , который несет бета-лактамазу для устойчивости к ампициллину и цефалоспоринам первого поколения.

    ПРОТИВОМИКРОБНАЯ ТЕРАПИЯ

    Лечение не требуется в большинстве случаев самокупирующегося мезентериального лимфаденита и илеита, проявляющихся лихорадкой и болью в животе. Кроме того, диагноз не доступен по культуре во время острого заболевания у пациентов. С другой стороны, пациентов с септицемией необходимо лечить как можно скорее, чтобы предотвратить летальный исход. В их интересах большинству пациентов с септицемией будет эмпирически назначен антимикробный режим лечения лихорадки до постановки диагноза Y.псевдотуберкулез  был установлен. Пациенты должны получать ампициллин (от 100 до 200 мг/кг/день внутривенно) или тетрациклин, доксициклин или аминогликозид в стандартных дозах при тяжелых инфекциях. Офлоксацин 400 мг/день и цефтриаксон 2 г/день успешно применялись у пациента с септическим артритом (4). Ампициллин и гентамицин успешно применялись у пациента с абсцессами селезенки (19). Больному с инфицированной аневризмой аорты проведена хирургическая резекция с последующим назначением цефтриаксона 1 г/сут и ципрофлоксацина 200 мг 3 раза/сут внутривенно (7).

    ДОПОЛНИТЕЛЬНАЯ ТЕРАПИЯ

    У пациентов с кишечным иерсиниозом были выполнены ненужные аппендэктомии. Компьютерная томография брюшной полости может выявить брыжеечный лимфаденит, чтобы исключить острый аппендицит, что позволяет пациентам не оперироваться. Хирургия, с другой стороны, была уместна у пациентов с инфицированными аневризмами и абсцессом селезенки (7, 19). Пациентам с реактивным артритом помогает лечение нестероидными противовоспалительными средствами, внутрисуставными инъекциями стероидов и физиотерапия.

    КОНЕЧНЫЕ ТОЧКИ ТЕРАПИИ

    Пациентам с септицемией внутривенно вводят противомикробные препараты в течение примерно 14 дней. За это время у пациентов должна снизиться температура и исчезнуть симптомы инфекции. Если используется гентамицин или другие аминогликозиды, следует измерить концентрацию антибиотика в сыворотке, чтобы убедиться в терапевтической эффективности и избежать токсичности. Рекомендуются анализы крови на креатинин сыворотки и функцию печени, а также общий анализ крови.

    ВАКЦИНЫ

    В настоящее время нет доступных вакцин.

    ПРЕДУПРЕЖДЕНИЕ

    Эти инфекции передаются в основном через зараженную пищу. Свежие продукты, такие как морковь и салат, следует мыть перед употреблением и не хранить в открытых контейнерах, доступных для грызунов. Следует избегать непастеризованных молочных продуктов и сырого или недоваренного мяса, особенно свинины.Не рекомендуется длительное охлаждение пищи перед употреблением, поскольку Yersiniae способны расти при 4 0 C.

    ССЫЛКИ

    1. Achtman M, Zurth K, Morelli G, Torrea G, Guiyoule A, Carniel E. Yersinia pestis , возбудитель чумы, представляет собой недавно появившийся клон Yersinia pseudotuberculosis. ПНАС 1999; 96:14043-14048. [ПубМед]

    2.Бертелли Л., Масетти Р., Бардаси Г., Маретти М., Гаргано Т., Корсини И., Мельчионда Ф., Тассинари Д., Каццато С., Лима М., Пессион А. Два случая болей в животе у детей с брыжеечным лимфаденитом, вызванным инфекцией Yersinia pseudotuberculosis . . Дж. Педиатр 2014; 165:411. [PubMed]  

    3. Carnoy C, Mullet C, Muller-Alouf H, Leteurtre E, Simonet M. Суперантиген YPMa усугубляет вирулентность Yersinia pseudotuberculosis у мышей. Заразить Иммун 2000; 68:2553-2559.[PubMed]  

    4. Cormier G, Lucas V, Varin S, Hamelin J-P, Tanguy G. Yersinia pseudotuberculosis  инфекция поясничного дугоотростчатого сустава. Совместная кость позвоночника 2007; 74: 110-111. [ПубМед]

    5. Дикон А.Г., Хэй Х., Дункан Дж. Септицемия, вызванная Yersinia pseudotuberculosis – отчет о клиническом случае. Clin Microbiol Infect 2003;9:1118-1119. [ПубМед]

    6. Giannitti F, Barr BC, Brito BP, Uzal FA, Villanueva M, Anderson M. Yersinia pseudotuberculosis инфекции у коз и других животных, диагностированные в Калифорнийской системе лабораторий здоровья животных и безопасности пищевых продуктов: 1990–2012.J Vet Diagn Invest 2014; 26:88-95. [ПубМед]

    7. Hadou H, Elfarra M, Alauzet C, Guinet F, Lozniewski A, Lion C. Аневризма брюшной аорты, инфицированная Yersinia pseudotuberculosis . Дж. Клин Микробиол, 2006 г.; 44:3457-3458. [PubMed]  

    8. Хоумвуд Р., Гиббонс С.П., Ричардс Д., Льюис А., Дуэйн П.Д., Гриффитс А.П. Илеит, вызванный Yersinia pseudotuberculosis , при болезни Крона. Джей заразить 2003; 47:328-332. [ПубМед]

    9. Хадсон К.Дж., Бутон А.Х. Yersinia pseudotuberculosis  адгезины регулируют тканеспецифическую колонизацию и локализацию иммунных клеток в мышиной модели системной инфекции. Infect Immun 2006: 74:6487-6490.[PubMed]  

    10. Ялава К., Хаккинен М., Валконен М., Накари У.М., Пало Т., Халланвуо С., Оллгрен Дж., Сиитонен А., Нуорти Дж.П. Вспышка желудочно-кишечного заболевания и узловатой эритемы из-за тертой моркови, зараженной Yersinia pseudotuberculosis . J Infect Dis 2006;194:1209-1216.[ПубМед]

    11. Джалава К., Халланвуо С., Накари У.М., Рууту П., Кела Э., Хейнасмаки Т., Сиитонен А. , Нуорти Дж.П. Несколько вспышек инфекции Yersinia pseudotuberculosis в Финляндии. Дж. Клин Микробиол, 2004 г.; 42:2789-2791.[PubMed]     

    12. Lambertz ST, Nilsson C, Hallanvuo S. ПЦР в реальном времени на основе TaqMan для обнаружения Yersinia pseudotuberculosis в пищевых продуктах. Appl Environ Microbiol 2008;74:6465-6469. [ПубМед]

    13. Лампы Л.В., Мадхусудхан К.Т., Гринсон Дж.К., Пирс Р.Х., Массолл Н.А., Чайлз М.С., Дин П.Дж., Скотт М.А.Роль Yersinia enterocolitica и Yersinia pseudotuberculosis при гранулематозном аппендиците. Гистологическое и молекулярное исследование. Am J Surg Path 2001; 25:508-515. [ПубМед]

    14. Лаукканан Р., Мартинес П.О., Сиккинен К.М., Ранта Дж., Майджала Р., Коркеала Х. Передача Yersinia pseudotuberculosis  в цепочке производства свинины от фермы до скотобойни. Appl Envir Microbiol 2008; 74:5444-5450. [ПубМед]

    15. Локман Х.А., Гиллеспи Р.А., Бейкер Б. Д., Шахнович Э. Yersinia pseudotuberculosis продуцирует цитотоксический некротизирующий фактор. Infect Immun 2002:70:2708-2714. [PubMed]  

    16. Логсдон Л.К., Мексас Дж. Провоспалительная реакция, вызванная инфекцией дикого типа Yersinia pseudotuberculosis , подавляет выживание мутантов yop в желудочно-кишечном тракте и пейеровых бляшках. Infect Immun 2006;74:1516-1527. [PubMed]  

    17. Mecsas J, Bilis I, Falkow S. Идентификация аттенуированных штаммов Yersinia pseudotuberculosis и характеристика орогастральной инфекции у мышей BALB/c на 5-й день после заражения с помощью мутагенеза с сигнатурной меткой.Инфект Иммун 2001; 67:2779-2787. [PubMed]  

    18. Палья М. Г., Д’Ареццо С., Феста А., Дель Борго С., Лояконо Л., Антинори А., Антонуччи Г., Виска П. Yersinia pseudotuberculosis септицемия и ВИЧ. Emerg Infect Dis 2005; 11:1128-1130. [ПубМед]

    19. Rathmell WK, Arguin P, Chan S, Yu A. Yersinia pseudotuberculosis бактериемия и абсцесс селезенки у пациента с инсулиннезависимым сахарным диабетом. Уэст Дж Мед 1999; 170:110-112. [PubMed]  

    20.Римханен-Финне Р., Нисканен Т., Халланвуо С., Макари П., Хаукка К., Паюнен С., Сиитонен А., Ристолайнен Р., Пойри Х., Оллгрен Дж., Кууси М. Yersinia pseudotuberculosis , вызвавший крупную вспышку, связанную с морковью, в Финляндии, 2006 г. Эпидем Инфект 2008;4:1-6. [PubMed]  

    21. Санно А., Аспан А., Хествик Г., Якобсон М. Наличие Salmonella spp., Yersinia enterocolitica , Yersinia pseudotuberculosis и Escherichia coli 0157:H7 у диких кабанов.Эпидемиол Инфект 2014;6:1-6. [PubMed]  

    22. Тахара М., Баба К., Ваки К., Аракаки Ю. Анализ болезни Кавасаки, показывающий повышенные титры антител к Yersinia pseudotuberculosis . Acta Paediatr 2006; 95:1661-1664. [PubMed]  

    23. Таукс, РТ. Салат и псевдоаппендицит: Yersinia pseudotuberculosis как возбудитель пищевого происхождения. J Infect Dis 2004;189:761-763. [ПубМед]

    24. Ванантверпен Г., Ван Дамм И., Де Зуттер Л., Хоуф К.Внутрипартийная распространенность и количественная оценка патогенных для человека Yersinia enterocolitica и Y, pseudotuberculosis в миндалинах свиней при убое. Вет микробиол 2014; 169:223-227. [ПубМед]

    25. Васала М., Халланвуо С., Рууска П., Суокас Р., Сиитонен А., Хакала М. Высокая частота реактивного артрита у взрослых после вспышки Yersinia pseudotuberculosis 0:1, вызванной зараженной тертой морковью. Энн Реум Дис 2014; 73:1793-1796. [ПубМед]

    26.Винсент П., Леклерк А., Мартин Л., Дуез Ж.-М., Симонет М., Карниэль Э. Внезапное начало псевдотуберкулеза у людей, Франция, 2004–2005 гг. Emerg Infect Dis 2008; 14:1119-1122. [ПубМед]

    27.  Wunderink HF, Oostvogel PM, Frenay IHME, Notermans DW, Fruth A, Kuijper EJ. Трудности диагностики терминального илеита, вызванного Yersinia pseudotuberculosis . Eur J Clin Microbiol Infect Dis 2014; 33:197-200. [ПубМед]

     

    Yersinia pseudotuberculosis – обзор

    Yersinia pseudotuberculosis

    Y.pseudotuberculosis может поражать людей всех возрастов, но не менее 75% пациентов с клинически очевидным заболеванием составляют дети младше 15 лет. 99,185 Сообщалось об инфекции у детей раннего возраста. 99,225 Из 130 случаев, диагностированных в Великобритании с 1959 по 1970 год, мальчики заболевали в три раза чаще, чем девочки. 136 Инфекции чаще возникают в холодные месяцы года. 99,184 Сезонный зимний пик заражения человека, вызванный Y.pseudotuberculosis подобен таковому у диких и домашних животных. 114 115 185

    Показатели заболеваемости среди детей, живущих в сельской и городской местности, кажутся одинаковыми. Y. pseudotuberculosis иногда выявляли у здоровых людей. Воздействие на организм кажется необычным; антитела к Y. pseudotuberculosis были обнаружены только в одном из 2000 образцов сыворотки от лиц, не болевших иерсиниозом в анамнезе. 63 185

    Ю.pseudotuberculosis распространен во всем мире среди большого количества животных и птиц, но заражение происходит редко. 67 Наиболее часто заражаются морские свинки, грызуны и кролики 136 , и у них может развиться чумное заболевание. 67,95 Поражения у морских свинок можно легко спутать с поражениями, вызванными Y. pestis . Крысы и другие грызуны также могут болеть чумным заболеванием, вызываемым Y. pseudotuberculosis . Микроб можно культивировать с языка, миндалин, кишечника и крупных органов инфицированных животных. 157

    Заражение было зарегистрировано у различных домашних животных (крупный рогатый скот, овцы, козы, кошки, собаки, хомяки), пушных зверей, выращиваемых в промышленных масштабах (шиншиллы, норки, нутрия) и других диких или содержащихся в неволе животных (кролики, еноты, лисы, олени, бобры, обезьяны, пумы, кенгуру). Y. pseudotuberculosis обнаружен у более чем 50 видов птиц, 82,108,136 а эпизоотии встречались у индеек, уток, голубей и голубей, а также в вольерах канареек и вьюрков.Штаммы, полученные от животных и птиц в Соединенных Штатах, преимущественно относятся к серотипам 1a, 1b и 3. 136 185

    Инкубационный период болезни человека составляет от 41 часа до 20 дней. 99 При вспышке, связанной с пищевыми продуктами, в Финляндии средний инкубационный период составил 8 дней (рис. 113.1). 102 Микроорганизм может выживать в пресной водопроводной воде в течение 46 дней при комнатной температуре и в течение 8 месяцев при 4°C (39,2°F). Он может выживать при температуре 4°C в мясе в течение 145 дней, а в молоке и хлебе – в течение 2–3 недель. 136

    Редкие инфекции: Yersinia Enterocolitica и Yersinia Pseudotuberculosis.

    Y enterocolitica вызывает состояние, называемое энтероколитом, которое представляет собой воспаление тонкой и толстой кишки, которое возникает и часто рецидивирует, в основном у маленьких детей.

    Эти инфекции, по-видимому, приобретаются при употреблении зараженных продуктов, особенно сырых или недостаточно приготовленных продуктов из свинины, а также при употреблении непастеризованного молока.Они также могут заразиться при прикосновении к зараженному животному, употреблении зараженной колодезной воды или, в редких случаях, при переливании зараженных крови. Инфекции увеличиваются в частоте среди детей, чья иммунная система ослаблена. Инкубационный период составляет от 4 до 6 дней.

    Признаки и симптомы

    При наличии инфекции Y enterocolitica она вызывает не только воспаление тонкой и толстой кишки, но и такие симптомы, как диарея и лихорадка. У ребенка с этой инфекцией стул может содержать кровь и слизь.Эти симптомы могут длиться от 1 до 3 недель, иногда дольше.

    Наряду с этими более распространенными симптомами бактериемии могут быть подвержены очень маленькие дети, у которых в организме слишком много железа, например те, кто получает переливание крови, или чья иммунная система уже подавлена ​​или ослаблена из-за другого заболевания. распространение бактерий в кровь). У детей старшего возраста также могут быть симптомы, имитирующие аппендицит (синдром псевдоаппендицита), с болью и болезненностью в правой половине живота.В редких случаях эта инфекция может быть связана с такими состояниями, как боль в горле, воспаление глаз, менингит и пневмония. У детей старшего возраста боль в суставах или покраснение кожи (узловатая эритема) на голенях могут появиться после исчезновения самой инфекции.

    У детей с Y pseudotuberculosis , вероятно, разовьется лихорадка, сыпь и боль в животе, включая синдром псевдоаппендицита. У некоторых детей также может быть диарея, сыпь и избыток жидкости в области грудной клетки или суставных пространств.

    Когда звонить педиатру

    Обратитесь к педиатру, если стул вашего ребенка содержит прожилки крови. Ищите признаки обезвоживания, которые могут быть вызваны диареей вашего ребенка, включая сухость во рту, необычную жажду и снижение частоты мочеиспускания.

    Как ставится диагноз?

    Ваш педиатр может назначить тесты для обнаружения организмов Yersinia в стуле вашего ребенка. Признаки инфекции также можно увидеть, взяв мазки из горла и оценив их в лаборатории, исследовав мочу или проверив кровь на антитела к бактериям.

    Поскольку это относительно редкие инфекции, большинство лабораторий не проводят рутинных анализов на наличие Yersinia в фекалиях.

    Лечение

    У большинства детей инфекция проходит сама по себе. В некоторых случаях инфекции Yersinia необходимо лечить антибиотиками. Как и во всех случаях диареи, жидкости даются для предотвращения или лечения обезвоживания.

    Профилактика

    Убедитесь, что ваш ребенок не употребляет сырую или недоваренную свинину, непастеризованное молоко и загрязненную воду.Тщательно мойте руки водой с мылом после контакта с сырыми свиными кишками.

    Вакцины для предотвращения инфекции Yersinia не существует.

    Информация, содержащаяся на этом веб-сайте, не должна использоваться в качестве замены медицинской помощи и рекомендаций вашего педиатра. Могут быть варианты лечения, которые ваш педиатр может порекомендовать в зависимости от индивидуальных фактов и обстоятельств.

    Yersinia Pseudotuberculosis — обзор

    Бактерии

    гнание

    Йерсиния Псевдотубероз Инфекции были описаны в пленке Pteropus Rodricensis и Rousettus aegyptiacus , а в свободном диапазоне myotis myotis в Германии (Childs-Sanford et al al ., 2009; Мюльдорфер и др., 2010; Накамура и др., 2013 г.; Уильямс, 2004). У R. aegyptiacus грубые поражения включают спленомегалию, гепатомегалию, брыжеечную лимфаденопатию и белые или желто-белые узелки в селезенке, печени, почках и легких. Гистологические поражения включают абсцессы или нейтрофильное или некрогнойное воспаление в печени, селезенке, почках и легких; бактерии в почечных и легочных кровеносных сосудах; некроз костного мозга и грамотрицательные бациллы в очагах поражения (рис.25.11) (Чайлдс-Санфорд и др. , 2009; Накамура и др., 2013).

    Рисунок 25.11. Yersinia pseudotuberculosis в печени, Myotis myotis .

    (A) Коагуляционный некроз с центральным скоплением нейтрофилов и ободком лимфоцитов и гистиоцитов в печени летучей мыши, инфицированной Yersinia pseudotuberculosis . (B) Грамотрицательные коккобациллы в печени летучей мыши, зараженной Yersinia pseudotuberculosis. грамм.

    (Фото предоставлено К.Meuhldorfer, Институт исследований зоопарков и дикой природы им. Лейбница (IZW), Берлин, Германия)

    Инфекции Pasteurella -подобными бактериями были описаны у содержащихся в неволе Epomophorus wahlbergi из одной коллекции зоопарка с односторонней или двусторонней пневмонией, плевритом (Helmick et al., 2004), плевропневмония и/или гнойный или фибринозный эпикардит/перикардит ± миокардит с внутриочаговыми грамотрицательными плеоморфными коккобациллами. У некоторых из этих летучих мышей наблюдалась выраженная гиперплазия пневмоцитов II типа и гиперплазия бронхиального эпителия, что позволяет предположить наличие дополнительных патогенов. У двух Pteropus pumilus из того же учреждения были культивированы сходные бактерии из целлюлита задних конечностей и перелома с образованием абсцесса в пальце крыла; респираторные и сердечные поражения, наблюдаемые у E. wahlbergi , у этих летучих мышей не были идентифицированы (Helmick et al., 2004).

    Летальный случай, связанный с приблизительно 100 свободноживущими штаммами Eptesicus fuscus в Висконсине, США, был связан с Pasteurella multocida серотипа 1 как причиной острой фатальной септицемии с интерстициальной пневмонией.Макроскопические поражения включали консолидацию легких и спленомегалию. Микроскопически грамотрицательные коккобациллы были отмечены в сосудах и эндотелиальных клетках легких, печени и селезенки с альвеолярным тромбозом, эндотелиальным некрозом и нейтрофильной интерстициальной пневмонией (рис. 25.12) (Blehert et al., 2014). Системный пастереллез также тесно связан с хищничеством кошек. В одном исследовании европейских летучих мышей большинство изолятов Pasteurella , выделенных из органов 29 летучих мышей-веспертилионидов, были идентифицированы как P. multocida подвид. septica капсульный тип А, преобладающий штамм, обнаруживаемый в ротовой полости домашних кошек (Mühldorfer et al., 2011a). Pasteurella spp. также были зарегистрированы как патогены у отдельных свободно живущих европейских летучих мышей (Mühldorfer, 2013).

    Рисунок 25.12. Pasteurella multocida в легких, Eptesicus fuscus .

    Легкая острая интерстициальная пневмония с внутриклеточными и внеклеточными грамвариабельными бактериями с Pasteurella multocida септицемией.Браун-Хопс.

    Salmonella sp. серовары, способные инфицировать широкий круг хозяев, были идентифицированы как у здоровых, так и у септических летучих мышей. Salmonella серотипа enteritidis и Salmonella серотипа typhimurium были выделены из внутренних органов живущих на свободе летучих мышей с интерстициальной пневмонией и гнойным менингитом (Mühldorfer, 2013).

    Clostridium perfringens и C. sordellii описаны как причина геморрагической диареи у европейских видов веспертилионовых летучих мышей (Hajkova and Pikula, 2007; Mühldorfer et al., 2011б). Считается, что Clostridium perfringens вызывает гастрит у содержащихся в неволе крылоногих летучих мышей, которые потребляют неподходящую пищу (Olsson and Woods, 2008).

    У содержащихся в неволе крылоногих летучих мышей, α-гемолитических Streptococcus spp. иногда вызывают бронхопневмонию или подкожные абсцессы. Staphylococcus aureus был обнаружен у содержащихся в неволе крылоногих летучих мышей с сепсисом и остеомиелитом.

    Несколько видов потенциально патогенных бактерий, включая Salmonella серотипа typhi, Shigella flexneri , Campylobacter spp., Neorickettsia spp. В том числе N. Rizyiii , Escherichia COLI , Yersinia EnteroColitica , Borrelia SPP., Bartonella SPP., Гемотропный MyCoplasma SPP. и Enterococcus SPP. также были обнаружены у свободноживущих летучих мышей при отсутствии клинической картины заболевания (Brook et al., 2015; Brygoo et al., 1970; Marinkelle and Grose, 1968; Mascarelli et al., 2014; Mühldorfer, 2013; Mühldorfer et al. ., 2010, 2011а).

    Иерсиниоз — NYC Health

    Что такое иерсиниоз?

    Иерсиниоз – инфекция кишечника, вызываемая бактериями (микробами) Yersinia enterocolitica или Yersinia pseudotuberculosis . У детей может быть кровавый понос, а у взрослых могут возникнуть боли в суставах. Для получения данных о иерсиниозе в Нью-Йорке посетите сайт EpiQuery.

    Кто болеет иерсиниозом?

    Любой человек может заболеть иерсиниозом. Однако большинство случаев, вызванных Yersinia enterocolitis , возникают у младенцев и детей младшего возраста, тогда как Yersinia pseudotuberculosis в основном поражает лиц в возрасте от 5 до 20 лет.

    Как распространяется иерсиниоз?

    Иерсиниоз распространяется при употреблении в пищу или питье зараженной пищи или воды. Микробы Yersinia обнаружены у многих животных, особенно у свиней (свиней). Инфекции пищевого происхождения часто связаны с зараженной сырой свининой и продуктами из свинины.

    Где находятся микробы

    Yersinia ?

    Животные являются основным источником Yersinia . Отходы животных могут загрязнять воду, молоко и продукты питания и стать источником инфекции для людей или других животных.Бактерии были обнаружены в мясном ассорти, свиной грудинке, сыром молоке, мороженом, неправильно пастеризованном шоколадном молоке, тофу, моллюсках, озерах, ручьях, а также в диких и домашних животных.

    Каковы симптомы иерсиниоза?

    Люди, инфицированные бактериями Yersinia , могут иметь диарею, лихорадку и дискомфорт в животе. Симптомы могут имитировать аппендицит.

    Как скоро после заражения появляются симптомы?

    Симптомы обычно появляются в течение 3–7 дней после воздействия.

    Как диагностируется иерсиниоз?

    Иерсиниоз

    диагностируется путем выявления бактерий Yersinia в стуле (фекалиях).

    Как лечится иерсиниоз?

    Иерсиниоз можно лечить антибиотиками, такими как триметоприм-сульфаметоксазол. Yersinia обычно устойчива к пенициллину.

    Следует ли отстранить инфицированного человека от работы или учебы?

    Поскольку бактерии Yersinia находятся в стуле (фекалиях), только люди с активной диареей, которые не могут контролировать свой стул (например,г., младенцев, детей младшего возраста, некоторых инвалидов) следует изолировать. Большинство инфицированных людей могут вернуться на работу или в школу, когда их стул сформируется, при условии, что они тщательно моют руки после посещения туалета. Обработчики продуктов питания, медицинские работники и дети в детских садах должны получить разрешение Департамента здравоохранения, прежде чем вернуться к своей обычной деятельности. Это может потребовать последующего анализа стула, чтобы убедиться, что они больше не заразны.

    Как предотвратить иерсиниоз?

    Защитите свою еду от бактерий.

    • Всегда обращайтесь с сырой птицей, говядиной и свининой так, как будто они потенциально заражены, и обращайтесь с ними соответствующим образом: заворачивайте свежее мясо в полиэтиленовые пакеты на рынке, чтобы предотвратить попадание крови на другие продукты.
    • Быстро охлаждайте продукты; свести к минимуму выдерживание при комнатной температуре.
    • Разделочные доски и столы, используемые для приготовления пищи, следует мыть сразу же после использования, чтобы предотвратить перекрестное загрязнение другими продуктами.
    • Убедитесь, что достигается правильная внутренняя температура приготовления, особенно при использовании микроволновой печи.
    • Избегайте употребления сырого или недоваренного мяса.
    • Избегайте использования сырого молока.

    Чаще мойте руки.

    • Всегда тщательно мойте руки теплой проточной водой с мылом, прежде чем прикасаться к еде, кормить младенцев и после контакта с сырым мясом.
    • Поощряйте тщательное мытье рук с мылом и водой после посещения туалета или смены подгузников, а также до и после приготовления пищи.
    • Убедитесь, что дети, особенно те, кто имеет дело с домашними животными, тщательно моют руки.

    Yersinia pestis, возбудитель чумы, является недавно появившимся клоном Yersinia pseudotuberculosis

    Abstract

    Чума, одна из самых разрушительных болезней в истории человечества, вызывается Yersinia pestis . В этом исследовании мы проанализировали популяционную генетическую структуру Y. pestis и двух других патогенных видов Yersinia , Y. pseudotuberculosis и Y. enterocolitica . Фрагменты пяти генов домашнего хозяйства и гена, участвующего в синтезе липополисахарида, были секвенированы из 36 штаммов, представляющих глобальное разнообразие Y.pestis и по 12–13 штаммов каждого из остальных видов. Ни в одном из генов Y. pestis не было обнаружено разнообразия последовательностей, и эти аллели были идентичны или почти идентичны аллелям из Y. pseudotuberculosis . Таким образом, Y. pestis является клоном, который произошел от Y. pseudotuberculosis 1 500–20 000 лет назад, незадолго до первых известных пандемий чумы человека. Три биовара (Antiqua, Medievalis и Orientalis) были выделены микробиологами в пределах Y.клон pestis . Эти биовары образуют отдельные ветви филогенетического древа на основе полиморфизма длин рестрикционных фрагментов в расположении инсерционного элемента IS 100 . Эти данные согласуются с предыдущими выводами о том, что Antiqua вызвала пандемию чумы в шестом веке, Medievalis вызвала Черную смерть и последующие эпидемии во время второй волны пандемии, а Orientalis вызвала нынешнюю пандемию чумы.

    Род Yersinia содержит три патогенных вида, Y.pestis , возбудитель чумы, и кишечные возбудители, передающиеся через пищу и воду Y. pseudotuberculosis и Y. enterocolitica. Y. pestis — это в первую очередь болезнь грызунов или других диких млекопитающих, которая обычно передается блохами и часто приводит к летальному исходу. Заболевание человека в настоящее время встречается редко и обычно связано с контактом с грызунами и их блохами. Однако три прежние волны пандемической чумы достигли Европы разными путями (рис. 1) и затронули очень значительную часть населения: считается, что первая пандемия (чума Юстиниана, 541–767 гг. н.э.) была занесена с Востока или из Центральной Африки и распространился из Египта в страны, окружающие Средиземноморье (1).Вторая пандемия (Черная смерть и последующие эпидемии с 1346 г. до начала 19 в.) распространилась из Каспийского моря на всю Европу и, возможно, была завезена из Центральной Азии. Третья пандемия началась в середине 19 века в провинции Юньнань в Китае и распространилась по всему миру через морские перевозки из Гонконга в 1894 г., в том же году, когда Yersin впервые описал Y. pestis (2, 3).

    Рисунок 1 Маршруты

    , по которым следуют три волны пандемии чумы, обозначенные цифрами 1, 2 и 3.Цифры в кружках обозначают регионы, которые считаются источниками этих волн пандемии.

    Y. pestis был разделен на три биовара (Antiqua, Medievalis и Orientalis) на основе незначительных фенотипических различий. Эпидемиологические наблюдения и исторические записи привели к гипотезе (4), что биовар Antiqua, обитающий в Африке, произошел от бактерий, вызвавших первую пандемию, тогда как Medievalis, обитающий в Центральной Азии, произошел от бактерий, вызвавших вторую пандемию.Все бактерии, эпидемиологически связанные с третьей пандемией, относятся к группе Orientalis и в настоящее время широко распространены.

    Помимо подразделения на три биовара, Y. pestis проявляет некоторую степень полиморфизма длины рестрикционных фрагментов по данным риботипирования и гель-электрофореза в пульсирующем поле (5) даже среди штаммов, выделенных из одной страны (6). Однако серотипирование и фаговое типирование не выявили разнообразия. Кроме того, результаты гибридизации ДНК-ДНК (7) показывают, что Y.pestis тесно связан с Y. pseudotuberculosis , и последовательности их 16S рРНК идентичны (8). Эти результаты привели к предложению (7) реклассифицировать Y. pestis и Y. pseudotuberculosis как два родственных подвида. Однако Y. pestis вызывает фатальную бубонную чуму и передается через укусы блох, тогда как Y. pseudotuberculosis передается фекально-оральным путем и редко приводит к смерти. По этим причинам и из-за исторической важности г.pestis для истории человечества, реклассификация Y. pestis и Y. pseudotuberculosis была отклонена медицинскими микробиологами. Причины различий в вирулентности между Y. pestis и Y. pseudotuberculosis до сих пор неизвестны, но могут отражать тот факт, что Y. pestis содержит две pestis -специфические плазмиды (9), одна из которых кодирует мышиный токсин, гомолог фосфолипазы D, который способствует колонизации средней кишки блох (10),§ таким образом усиливая передачу инфекции от хозяина к хозяину.Несколько хромосомно-ассоциированных свойств, связанных с вирулентностью, идентифицированных к настоящему времени у Y. pestis , также обнаруживаются, по крайней мере, у некоторых штаммов Y. pseudotuberculosis и, как считается, не объясняют различий в их болезнетворном потенциале.

    Последовательности ДНК нескольких генов домашнего хозяйства можно использовать для определения филогенетической истории таких видов бактерий, как Salmonella enterica (11). Мультилокусное типирование генов «домашнего хозяйства» выявило существование клональных группировок даже у таких видов бактерий, как Neisseria meningitidis (12), Streptococcus pneumoniae (13) и Helicobacter pylori (14), которые характеризуются высоким уровнем рекомбинация (15, 16).У видов, у которых горизонтальный генетический обмен встречается редко, полиморфизм последовательностей отражает накопление мутаций с одинаковой частотой и коррелирует со временем, прошедшим с момента существования последнего общего предка. Анализ изменчивости последовательностей показал, что Mycobacterium tuberculosis (17) и Plasmodium falciparum (18) имеют возраст всего несколько тысяч лет. Напротив, последний общий предок Escherichia coli и S. enterica существовал примерно 140 миллионов лет назад (19).

    Здесь мы показываем, что Y. pestis является очень однородным клоном Y. pseudotuberculosis , который возник незадолго до первых известных пандемий чумы, и что эти три биовара филогенетически различны, что согласуется с уникальными ассоциациями с каждым из три пандемии.

    Материалы и методы

    Бактериальные штаммы.

    Семьдесят шесть штаммов Y. pestis всех трех биоваров (Antiqua, Medievalis и Orientalis) были выделены в период с 1942 по 1998 год от людей, блох и мелких млекопитающих в разных странах (таблица 1 и рис.2). Фрагменты генов были секвенированы из 36 штаммов, а типирование по IS 100 выполнено для 49. фрагменты (табл. 1).

    Таблица 1

    Аллели шести фрагментов гена у трех видов Yersinia

    фигура 2

    Соседнее филогенетическое дерево паттернов полос IS 100 в 49 штаммах Y. чума .

    Генные фрагменты и последовательности.

    Олигонуклеотидные праймеры

    были разработаны на основе последовательностей dmsA (анаэробная ДМСО-редуктаза, цепь A), glnA (глутаминсинтетаза, EC 6.3.1.2), manB (фосфоманномутаза), thrA (аспартокиназа). ), tmk (тимидилаткиназа, EC 2.7.4.9) и trpE (компонент I антранилатсинтазы, EC 4.1.3.27) из Y.pestis Sanger Center Genome Project (http://www.sanger.ac.uk/Projects/Y_pestis/) или из родственных бактерий в GenBank. Гены были амплифицированы с помощью ПЦР из хромосомной ДНК Y. pestis или Y. pseudotuberculosis с использованием следующих комбинаций праймеров (последовательности 5′-‘): dmsA , O1151, GTTCTTGTGGACCGATGCCA и O1152, AAGATCCGCACCATAGTCTCCA; glnA , O1153, CTGCAGTTATGGACCCGTTC и O1155, GCGGTAGCCACTTCGTGGTG; manB , O1144, AAAGCCTATGATATTCGTGG и O1145, TAGTGATGAGCACTCATTTC; thrA , O1141, GGTGACGGTATGCGCACCATGCG и O1143, GTCAACAATGACCGGGTTCAG; тмк , O1148, TATTGAAGGGCTTGAAGGGG и O1150, AATGGGTTGGGAGGCATCAAT; trpE , O1146, CCGTATCGAGTTGGAAATGC и O1147, CACCCGCTTGTACGGTGGCGA. ДНК из Y. enterocolitica амплифицировали с использованием следующих праймеров: dmsA , O1310, GAGAAATGCGAAATGATTGTGG и O1152; glnA , O1267, CATTAACGAATCCGACATGG и O1268, GGTCATACAGGTTTTTGTCC; manB , O1144 и O1145, O1274, GTATTCCAAGTTAAACGTGG или O1328, TCGTGGATGATCTTCGCGCC; через A , O1141 и O1290, GGTGTTGGCCTTTTTGTTYGGCG; тмк , О1148 и О1150; trpE , O1331, AACGTCTCACTGCTCGCCTG и O1308, GGTCTCCTGTGCATGATGCG.Независимые продукты ПЦР секвенировали из обеих цепей с использованием терминаторов, меченных dRhodamine (секвенатор PE Applied Biosystems 377). Реакции секвенирования проводили с использованием праймеров для амплификации, за исключением следующих генов из Y. enterocolitica : glnA , O1153 и O1312, AATGCGTGTGCCACGTTGTG; thrA , O1315, GTTTGCGCACCTTGCGTGGG и O1290; trpE , O1331 и O1307, TTACGGGTTTCRTCRGCTTC. Последовательности были обрезаны до одинаковой длины для каждого гена после многократного выравнивания (pileup, Wisconsin Package, Version 9. 1; Genetics Computer Group, Мэдисон, Висконсин). Средние расстояния между аллелями в синонимичных (D S ) и несинонимичных (D N ) сайтах рассчитывали после коррекции Jukes-Cantor (20) с использованием dnasp 3.14 (21). Для расчетов возраста использовалась формула: где скорость скорость молекулярных часов. Для расчета возраста последовательностей pestis использовали следующую формулу: где полиморфизма = 2,996 (95% доверительный интервал) или 0,693 (50% доверительный интервал) и N i × l i равно количество последовательностей, умноженное на количество потенциальных синонимичных сайтов в каждой последовательности (18).

    Полиморфизм длины фрагмента рестрикции Анализ расположения IS

    100 в Y. pestis .

    Зонд IS 100 длиной 255 п.н. был амплифицирован с помощью ПЦР из ДНК штамма 6/69 с использованием праймеров IS 100 -F, AAAACGTTCGAAGAGTATGA и IS 100 -R, GATGAGCAGGCGGGGGGCCA и пероксидазы. система прямого мечения и обнаружения нуклеиновых кислот с усиленной хемилюминесценцией (Amersham Pharmacia). Зонд использовали для Саузерн-гибридизации с Eco RI-расщепленной геномной ДНК от Y.pestis после разделения с помощью гель-электрофореза [0,8% агароза, 50 В в течение ночи в буфере TBE (89 мМ трис/89 мМ борная кислота/2 мМ ЭДТА, рН 8,3)]. Щелочную денатурацию, нейтрализацию и перенос ДНК на фильтры Hybond-N (Amersham Pharmacia) с помощью аппарата VacuGene (Amersham Pharmacia) проводили, как описано (22). Картины гибридизации сканировали, а компьютеризированные данные анализировали с использованием gelcompar 4.0 (Applied Mathematics, Кортрейк, Бельгия). Филогенетические деревья профилей гибридизации были построены с помощью gelcompar с использованием метода соседнего соединения.

    Результаты

    Аллелей шести фрагментов гена.

    для расследования структуры населения патогенной йорниа вида , мы секвенировали фрагменты ≈400 п. н. пятью уборковых генов ( Thra , TRPE , глна , TMK и DMSA ) и шестого гена ( manB ) участвует в биосинтезе липополисахаридов. Последовательности были получены из 36 различных штаммов Y.pestis , 12 штаммов Y. pseudotuberculosis и 13 штаммов Y. enterocolitica , за исключением того, что нам не удалось секвенировать manB из двух штаммов Y. pseudotuberculosis и dmsA 9004 Y. enterocolitica (табл. 1). Каждой уникальной последовательности был присвоен разный номер аллеля, в результате чего для каждого гена было от 4 до 13 аллелей (таблица 1). Различие между различными аллелями анализировали, вычисляя среднее процентное различие как в синонимичных (%D S ), так и несинонимичных (% D N ) сайтах.

    Все 36 штаммов Y. pestis обладали идентичными аллелями для всех шести фрагментов гена (табл. 1). Кроме того, идентичные аллели thrA1 , glnA1 и manB1 были обнаружены у Y. pestis и некоторых штаммов Y. pseudotuberculosis . Для трех других фрагментов гена были обнаружены аллели Y. pseudotuberculosis , кодирующие полипептиды, идентичные полипептидам из Y. pestis ( trpE и dmsA ) или отличающиеся только несинонимичными сайтами ( tmk ) (Tmk ) (Tmk ). ).Расстояния между аллелями Y. pestis и Y. pseudotuberculosis находились в пределах диапазона, наблюдаемого только у Y. pseudotuberculosis , за одним незначительным исключением (процент D N для tmk ). Эти наблюдения показывают, что Y. pestis является высококонсервативным клоном Y. pseudotuberculosis , который дифференцировался так недавно, что пока накопилось лишь несколько полиморфизмов последовательностей. Если бы не традиция, результаты также оправдывали бы изменение имени Y.pestis , чтобы отразить тот факт, что это не самостоятельный вид.

    Таблица 2

    Средний процент попарных различий в синонимичных (% D S ) и несинонимичных (% D N ) сайтах шести фрагментов гена

    Y. enterocolitica также относительно однороден. Все 13 штаммов Y. enterocolitica обладали идентичными аллелями thrA и trpE , а среднее разнообразие синонимических последовательностей glnA , tmk и dmsA , Э.coli и намного ниже, чем у N. meningitidis (15) и H. pylori (14). manB исключительно изменчив, как и другие гены, участвующие в биосинтезе липополисахарида у Salmonella (23) и E. coli (24), что, возможно, отражает как минимум три различных случая импорта из неродственных бактерий (данные не показаны).

    Соседние филогенетические деревья

    (не показаны) дополнительно подтверждают выводы, описанные выше: все аллели из Y.pestis плюс Y. pseudotuberculosis плотно сгруппированы, как и все аллели из Y. enterocolitica , кроме manB. Самым драматичным аспектом деревьев было большое расстояние между Y. pestis / Y. pseudotuberculosis и Y. enterocolitica . Действительно, практически все синонимичные сайты шести фрагментов гена и 4–20% несинонимичных сайтов различались между Y. pestis и Y. enterocolitica (табл. 2).Эти значения сравнимы или превышают уровень разнообразия последовательностей в генах домашнего хозяйства между E. coli и Salmonella (25).

    Возраст с момента происхождения от последнего общего предка.

    Если разнообразие последовательностей накапливается с относительно постоянной скоростью (гипотеза молекулярных часов), вариации последовательностей в синонимичных сайтах можно использовать для расчета времени существования последнего общего предка. Синонимическая тактовая частота была рассчитана Whittam (26) как 6 × 10 -9 синонимичных полиморфизмов, накопленных за год на основе того, что E.coli и S. enterica типа typhimurium в последний раз имели общего предка примерно 140 миллионов лет назад (19), и с тех пор 95% синонимичных участков были заменены местами (25). В 5 раз более высокая частота 3 × 10 -8 была рассчитана Guttman и Dykhuizen (27) на основании того, что частота мутаций составляет примерно 10 -10 и что E. coli претерпевают примерно 300 поколений. в год в естественных условиях. Средние процентные значения D S затем напрямую дают расчетное время, прошедшее с момента существования последнего общего предка, при условии, что ход молекулярных часов для Yersinia и E.coli сопоставимы. Время с момента разделения Y. pestis и Y. enterocolitica оценивается в 41–186 млн лет, за исключением thrA и manB, , для которых синонимичный полиморфизм был насыщенным. Точно так же последний общий предок Y. pestis плюс Y. pseudotuberculosis существовал 0,4–1,9 миллиона лет назад.

    Максимальный возраст Y. pestis можно оценить с помощью несколько иного подхода (18), который обусловлен отсутствием изменчивости их последовательностей.Согласно распределению Пуассона, верхний 95% доверительный интервал числа полиморфизмов, которые могут привести к нулю наблюдаемых полиморфизмов, составляет 2,996, а 50% доверительный интервал равен 0,693. Подстановка этих оценок на нулевые полиморфизмы позволяет рассчитать время, прошедшее с момента последнего узкого места, от которого произошли все штаммы Y. pestis . Экстремальные значения, рассчитанные как по оценкам хода часов, так и по обоим доверительным интервалам, составляют от 1056 лет [доверительный интервал 50 %, Guttman and Dykhuizen (27)] до 20 436 лет [доверительный интервал 95 %, Whittam (26)].Эти расчеты также дают дату, когда Y. pestis дифференцировался от Y. pseudotuberculosis , потому что более ранняя дифференциация (и множественные узкие места) должна была привести к накоплению полиморфизмов, тогда как все аллели в Y. pestis были идентичными или почти идентичными. идентичны аллелям, все еще присутствующим в Y. pseudotuberculosis . Юстинианова чума была 1500 лет назад, а значит, Y. pestis не менее 1500 лет.

    Микроэволюция внутри

    Y. pestis .

    Y. pestis не является полностью однородным. Крайне незначительные вариации последовательности были отмечены в других анализах (28), а рестрикционные анализы выявили значительную вариабельность (5, 29). M.tuberculosis так же однороден, как Y.pestis (17), и все же различия между отдельными штаммами могут быть достоверно распознаны по полиморфизму длины рестрикционных фрагментов, вызванному вариабельным хромосомным расположением вставочного элемента (30).Поэтому мы определили характер полиморфизма длин рестрикционных фрагментов геномной ДНК 49 штаммов всех трех биоваров после расщепления Eco RI и гибридизации с зондом, специфичным к элементу IS 100 . Полосы с более высокой молекулярной массой, которые были плохо разделены, не оценивались, оставляя 17–38 отдельных полос на штамм. Штаммы биовара Antiqua имели около 30 полос, тогда как штаммы биоваров Medievalis и Orientalis имели в среднем 20 полос.Количество полос, общих для каждой пары штаммов, использовали для построения филогенетического дерева с соседним соединением (рис. 2). Три биовара были сгруппированы в независимых частях дерева без каких-либо перекрытий, что предполагает различное происхождение от общего корня для всех трех. Кроме того, расстояние между ветвями было самым коротким у биовара Orientalis и большим у штаммов Medievalis и Antiqua. UPGMA ( U nвзвешенный P воздух G roup M ean A среднее) кластеризация и расщепление декомпозиции дали сопоставимые результаты (данные не показаны).Известно, что ориенталис был ответственен за большинство случаев заболевания во время третьей пандемии. Более длинные ветви, связанные с Medievalis и Antiqua, предполагают, что эти бактерии имеют более старую эволюционную историю и действительно могли пережить предыдущие волны пандемии.

    Обсуждение

    Y. pestis является клоном Y. pseudotuberculosis , который эволюционировал так недавно, что до сих пор имеет сильную гомологию последовательностей с этим видом. Отсутствие изменчивости на 21 881 синонимическом сайте в пределах 36 лет.pestis показывает, что штамм Y. pestis , вероятно, развился в течение последних 1500–20 000 лет. Эта оценка возраста предполагает аналогичную тактовую частоту для Yersinia и E. coli . Если бы Y. pestis имели более низкую частоту мутаций или меньше поколений в год, чем E. coli , наша оценка возраста была бы слишком низкой. Однако частоты устойчивых к рифампицину мутантов после выращивания при 28°С для шести штаммов Y. pestis и трех штаммов Y.pseudotuberculosis были сравнимы или немного превышали таковые для E. coli K-12 (данные не показаны), что подтверждает использование часов, которые были откалиброваны для E. coli . Вторая потенциальная проблема заключается в том, что из-за отсутствия вариации последовательности расчеты оценивают максимальный, а не реальный возраст, и верхний предел в 20 000 лет может оказаться слишком большим. Из-за этих соображений два разных хода часов (26, 27) были объединены с пределами вероятности 50% и 95%, чтобы получить большой диапазон, 1500–20000 лет, для оценки возраста лет.чума . Это реалистичная оценка возраста этого вида, заметно отличающаяся от миллионов лет, приводимых в популярной литературе (31).

    Селективное давление, которое привело к недавней эволюции Y. pestis , неизвестно. Предполагается, что M. tuberculosis произошел от бычьего патогена Mycobacterium bovis около 15 000 лет назад, что соответствует дате одомашнивания крупного рогатого скота (17, 32). Возможные объяснения эволюции P.falciparum около 5000 лет назад, включают латеральную передачу человеку от вида животных, изменения в поведении человека, недавнюю эволюцию комаров-переносчиков и изменения в ассоциации хозяин-паразит-переносчик (18). Ни одно из этих объяснений не обязательно применимо к Y. pestis , потому что он поражает множество мелких млекопитающих и не является в первую очередь патогеном для человека. Очевидная корреляция между изменившимися социальными и экономическими факторами, вызванными увеличением численности населения, и недавней эволюцией Y.pestis , таким образом, может представлять собой чистое совпадение. В качестве альтернативы, развитие сельского хозяйства могло значительно увеличить запасы пищи для определенных грызунов, и в результате их увеличение размера популяции и изменения в поведении могли спровоцировать эволюцию Y. pestis. Мы отмечаем, что эффективные переносчики (крысиная блоха, Xenopsylla cheopis ) и хозяева с историей лесной чумы (травяная крыса, Arvicanthis niloticus ) обычны в источниках первой пандемии, Восточной Африке (33) и Египет (34).Развившись в одном виде грызунов, Y. pestis затем смог быстро распространиться на большое количество других мелких млекопитающих, менее затронутых человеческой цивилизацией.

    Какие генетические изменения потребовались для эволюции Y. pestis ? Хотя было заявлено, что мутаций в inv (35) и yadA (36) достаточно, чтобы повысить вирулентность Y. pseudotuberculosis до вирулентности Y. pestis (37), последующая работа (38) указал, что эти результаты могут отражать проблемы с конструкциями неизогенных штаммов.Точно так же продукт гена Y. pestis hms приводит к блокированию преджелудков блох и, таким образом, усиливает опосредованную блохами передачу между хозяевами (39). Однако функциональный локус hms не является исключительным для Y. pestis , а также был обнаружен у некоторых штаммов Y. pseudotuberculosis (40). Единственным известным уникальным фактором вирулентности является активатор плазминогена Pla, который кодируется 9,5-т.п.о. Y. pestis -специфической плазмидой pPla и, по-видимому, важен для системного распространения бактерий после s.в. инъекции (41). Тем не менее, некоторые штаммы Y. pestis , излеченные от pPla, не изменили вирулентность для экспериментальных животных даже после подкожного введения. инфекция (42, 43). Таким образом, в настоящее время единственной уникальной особенностью Y. pestis , которая, как считается, усиливает передачу блохами, является гомолог фосфолипазы D, кодируемый ymt на плазмиде pFra длиной 100 т.п.н. (10). §

    Следующий весьма спекулятивный эволюционный сценарий использует известные черты Y.pestis , которые отличают его от Y. pseudotuberculosis , и иллюстрируют один из возможных путей этой эволюции. Y. pseudotuberculosis иногда вызывает фатальную септицемию у животных, подвергшихся стрессу от холода, голода или отлова, и иногда может передаваться блохам в природе (44) и в лаборатории (45). Решающим шагом к эволюции патогенного штамма Y. pestis , который может передаваться блохами другим млекопитающим, могло стать приобретение плазмиды pFra штаммом Y.pseudotuberculosis от неизвестного донора при коколонизации желудочно-кишечного тракта грызунов или средней кишки блохи. Комбинации хромосомно кодируемого белка Hms (39) и кодируемого pFra гомолога фосфолипазы D (10) могло быть достаточно для более эффективного переноса эктопаразитами другим животным. Последующее приобретение плазмиды pPla могло усилить способность к диссеминации после инокуляции в кожу. IS 100 присутствует в Y. pseudotuberculosis и предположительно был унаследован новым штаммом.Транспозиционные мутации IS 100 могли случайно разрушить способность штаммов колонизировать желудочно-кишечный тракт и оставить только передачу через блох и других переносчиков в качестве единственного средства выживания. Если бы исходные продукты гена hms в Y. pseudotuberculosis не были способны эффективно блокировать преджелудки блох, необходимость выживания за счет передачи эктопаразитов привела бы к мутациям, повышающим эту эффективность. Напротив, белки, необходимые для передачи фекально-оральным путем, больше не будут нужны, что приведет к отсутствию селективного давления на мутации (35) в ure (уреаза против желудочной кислоты), inv , ail , и yadA (все необходимые для транслокации через кишечный барьер).

    Последующая микроэволюция привела к трем линиям, называемым биоварами Antiqua, Medievalis и Orientalis. Antiqua восстанавливает нитраты и ферментирует глицерин, тогда как Medievalis не восстанавливает нитраты, а Orientalis не ферментирует глицерин (4), как если бы Antiqua был предком как Medievalis, так и Orientalis. Девиньат объединил это наблюдение с историческими и эпидемиологическими записями и предположил, что каждая из трех волн пандемии была вызвана другим биоваром (4), а именно первая волна пандемии, вызванная Antiqua, вторая волна пандемии, вызванная Medievalis, и третья, нынешняя волна пандемии. от Ориенталис.Штаммы биовара Antiqua продолжают выделяться из Восточной и Центральной Африки, предполагаемого источника первой волны пандемии, а штаммы Medievalis продолжают выделяться в Курдистане, регионе, граничащем с Каспийским морем, через который прошла вторая пандемия, прежде чем достичь Европы. Эпидемиологические ассоциации для третьей пандемии очень сильны: исключительно биовар Orientalis выделен из большинства стран, зараженных морским судоходством в конце прошлого века.

    Биовары группируются отдельно в филогенетическом дереве, основанном на хромосомном расположении элемента вставки (рис.2). Эти данные предоставляют молекулярные доказательства, подтверждающие разделение Y. pestis на биовары (4). Более длинные ветви Antiqua и Medievalis согласуются с гипотезой о том, что они эволюционировали раньше, чем Orientalis, и с отнесением Devignat биовара Antiqua к первой пандемической волне человеческой чумы, а биовара Medievalis ко второй волне (4).

    Благодарности

    Мы благодарим за полезные комментарии Эдди Холмса, Дэна Дайхуйзена, Гая Барантона и Себастьяна Суэрбаума, а также двух анонимных рецензентов.Эта работа была поддержана грантом DFG Ac 36/10-1 от Deutsche Forschungsgemeinschaft и грантами 97/25200/DCE/CEB (Centre d’Etude du Bouchet) и 93811-77/A000/DRET/DS (Direction de la Recherche et de la Technologie, Министерство обороны, Франция).

    Сноски

    • ↵† Кому следует направлять запросы на перепечатку. Электронная почта: achtman{at}molgen.mpg.de.

    • Этот документ был отправлен непосредственно (трек II) в офис PNAS.

    • Депонирование данных: последовательности, о которых сообщается в этой статье, были депонированы в базе данных GenBank (номер доступа AJ250236-41 и AJ270406-50).

    • ↵§ Хиннебуш, Дж., Шван, Т., Рудольф, А., Диксон, Дж., Черепанов, П. и Форсберг, А., Девяносто девятое общее собрание Американского общества микробиологии, 30 мая – 3 июня , 1999, Чикаго, Иллинойс (D/B-236).

      • Copyright © 1999, Национальная академия наук

      Цитотоксичный коэффициент некротизации Йерсинии псевдотуберкулез (CNFY) переносятся на внеклеточные мембраны везикул к клеткам-хозяинам

      бактериальные штаммы и условия роста

      Yersinia Pseudotuberculosis ATCC 29833 был получен из Корейской коллекции сельскохозяйственных культур (KACC) (http://genebank.rda.go.kr/eng/uat/uia/actionMain.do)) и Y. pseudotuberculosis YPIII был получен из Репозитория ресурсов для исследования биозащиты и новых инфекций (BEI Resources, США). Бактериальные штаммы содержали в виде замороженных 20% растворов глицерина при температуре -80 °C. При необходимости их выращивали на чашках с агаром с лизогеновым бульоном (LB) (BD; Difco, США) при 30 °C в течение ночи. После этого одну колонию инокулировали в 5 мл бульона LB и выращивали в течение ночи при 30°C при перемешивании (250 об/мин).

      Культуры клеток человека

      Клетки HeLa, которые мы приобрели в Американской коллекции типовых культур (ATCC; www.atcc.org) культивировали в колбах Т75 в модифицированной среде Иглса Дульбекко (MEM, 1:1 с бикарбонатом натрия (Life Technologies, США)) с добавлением 10% термоинактивированной фетальной бычьей сыворотки и 100 мкг/мл нормоцина (Invivogen, США). .

      Очистка MV

      MV были очищены, как указано выше 26 , с небольшой модификацией. Вкратце, 500 мл бактериальных культур выращивали в среде LB при 30°C и 250 об/мин в 2-литровых колбах в течение 24 ч (OD600 ~2,3). Бактериальные клетки и дебрис удаляли низкоскоростным центрифугированием (5000×g, 30 мин) и среду стерилизовали, пропуская ее через 0.Фильтр 2 мкм (Millipore, США). Бесклеточную среду концентрировали до ~5 мл с использованием фильтра Amicon MWCO 100 кДа (США). Концентрированные ВВ осаждали ультрацентрифугированием (40000 об/мин, 2 ч, 4°С) и суспендировали в 25 мМ HEPES (рН 7,5). Затем их смешивали с OptiPrep (Sigma Aldrich, США) для получения 40% (об./об.) раствора OptiPrep в общем объеме 2 мл. Образцы загружали в ультрацентрифужную пробирку объемом 13,2 мл, а сверху наносили растворы OptiPrep более низкой концентрации (2 мл [40%], 2 мл [30%], 2 мл [25%], 2 мл [20%]. , 1 мл [15%] и, наконец, 0.5 мл [0%]). Образцы центрифугировали (100 000 × g, 16 ч, 4 °C) в бакетном роторе, после чего фракции по 1 мл последовательно собирали из верхней части пробирки. Содержание белка в каждой фракции исследовали с помощью 10% трис-глициновых гелей SDS-PAGE (Biorad, США). Соседние фракции с аналогичными белковыми профилями объединяли, разбавляли 25 мМ HEPES (pH 7,5) и выделяли с помощью ультрацентрифугирования (100 000×g, 2 ч, 4°C). Восстановленные осадки затем ресуспендировали в 25 мМ HEPES (pH 7.5) и концентрацию MV, определенную с помощью анализа Брэдфорда.

      ПЭМ-анализ бактерий и МВ

      Для ПЭМ-изображений 2 мкл очищенных МВ или бактериальной культуры помещали на сетки с углеродным покрытием (Polysciences, Inc., США). Образцы обрабатывали 2,5% глутаровым альдегидом в течение 1 ч, промывали последовательно возрастающими количествами этанола (40%, 50%, 60%, 80%, 90% и 100%) и, наконец, абсолютным ацетоном. Затем образцы окрашивали отрицательно 0,1% раствором уранилацетата и исследовали в просвечивающем электронном микроскопе (JEOL 1200 EX, США).

      Протеомный анализ

      Yersinia pseudotuberculosis MV

      Для идентификации белков внутри MV три повторных образца для культур Y, pseudotuberculosis ATCC 29833 и YPIII подвергали расщеплению в геле. Для этого 10  мкг МВ (на основе анализа Брэдфорда) разделяли в 10% трис-глициновых гелях SDS-PAGE (Biorad, США). После окрашивания кумасси синим каждую дорожку разрезали на шесть частей и белки в каждой подвергали расщеплению трипсином в геле, как описано Шевченко и соавт. 41 .Полученные триптические пептиды анализировали методом ЖХ-МС/МС. Все массовые анализы проводились на LTQ-Orbitrap (Thermo, Бремен, Германия), оснащенном источником ионов с наноэлектроспреем. Для разделения смеси пептидов мы использовали колонку ВЭЖХ с обращенной фазой C18 (150 мм ×75 мкм, внутренний диаметр), используя градиент ацетонитрил/0,1% муравьиной кислоты от 10 до 24% в течение 90 мин при скорости потока 300 нл/мин.

      Для анализа МС/МС МС-спектры сканирования ионов-предшественников (m/z 400–2000) были получены в Orbitrap с разрешением 60 000 при m/z 400 с внутренней фиксирующей массой.20 наиболее интенсивных ионов были выделены и фрагментированы в линейной ионной ловушке методом столкновительно-индуцированной диссоциации (CID). Все образцы МС/МС анализировали с использованием Sequest (Thermo Fisher Scientific, Сан-Хосе, Калифорния, США; версия 1.4.1.14) и X! Тандем (GPM, thegpm.org; версия CYCLONE (2010.12.01.1)). Секвест и Х! Тандем был создан для поиска в базе данных белковых последовательностей Y. pseudotuberculosis (9823 записи, UniProt (http://www.uniprot.org/)) при условии расщепления трипсином. Секвест и Х! Поиск тандемов проводился с допуском по массе осколочного иона, равным 0.60 Да и допуск исходного иона 10,0 частей на миллион.

      Scaffold (версия Scaffold_4.4.3, Proteome Software Inc., Портленд) использовали для проверки идентификаций пептидов и белков на основе MS/MS. Идентификации белков принимались только в том случае, если они могли быть установлены с вероятностью более 99,0% для достижения уровня ложного обнаружения менее 1,0% и содержали не менее двух идентифицированных пептидов. Вероятности белков были заданы алгоритмом Protein Prophet. Белки, которые содержали сходные пептиды и не могли быть дифференцированы только на основе анализа МС/МС, были сгруппированы в соответствии с принципами экономии.Белки были аннотированы терминами онтологии их генов, которые были получены из базы данных NCBI (загружено 1 августа 2016 г.). Локализация идентифицированных белков определялась вручную с использованием программы прогнозирования субклеточной локализации бактериальных белков PSORTB v. 3.0 28 .

      Клонирование и экспрессия His-меченого CNFy

      Ген, кодирующий токсин CNFy в геноме Y. pseudotuberculosis YPIII, амплифицировали с помощью ПЦР с использованием праймеров CNF-F (5′-TAT TCTAGA TTTTACATGTAATAATAAATAGCAG-3′ ) и CNF-R (5′-ATA CTCGAG AAAGTCTTTTTGTAAAACATTAAAC-3′).Эти праймеры вводили сайты рестрикции для Xba 1 и Xho 1 (подчеркнутые области в праймерах соответственно). Полученный продукт ПЦР расщепляли с использованием этих ферментов, лигировали в pET-31b+ для получения слияния 6X his-Tag и трансформировали в E. coli DH5α. После подтверждения правильности вставки эту плазмиду (pET31B + CNFy) очищали и трансформировали в Y. pseudotuberculosis YPIII.

      Очистка CNFy

      Y.pseudotuberculosis YPIII, несущий pET31B + CNFy, выращивали в среде LB с добавлением 100  мкг/мл ампициллина. Когда культура достигала OD 1,0, клетки собирали центрифугированием при 5752 × g (15 мин), промывали PBS и затем суспендировали в лизирующем буфере (50 мМ трис-HCl, pH 7,5; 200 мМ NaCl), дополненном лизоцимом ( 1 мг/мл). Эту суспензию выдерживали на льду в течение 30 минут перед обработкой ультразвуком (амплитуда 20% для 30-секундных импульсов). После обработки ультразвуком клеточный дебрис удаляли центрифугированием при 5752×g в течение 30 минут при 4 °C.Затем рекомбинантный CNFy (rCNFy) очищали с помощью аффинной хроматографии с использованием агарозных шариков Ni-NTA (Qiagen, США) в соответствии с протоколом, предложенным производителем. Очищенный белок затем количественно определяли с использованием анализа Брэдфорда. Чтобы подтвердить чистоту белка, образец отделяли с помощью 10% геля SDS PAGE и визуализировали после окрашивания коллоидным кумасси (рис. S7). Экспрессия rCNFy в Y. pseudotuberculosis YPIII также была подтверждена вестерн-блоттингом с использованием набора Penta·His HRP Conjugate Kit от Qiagen (США) (фиг.2С).

      Полуколичественный анализ CNFy в МВ методом вестерн-блоттинга

      Образцы, содержащие 10  мкг белка из цельных клеток или МВ из Yersinia pseudotuberculosis YPIII pET31b-CNFy, разделяли на 4–20% трис-глициновых гелях SDS-PAGE ( Биорад, США). Образцы очищенного rCNFy (0,2 мкг, 0,1 мкг и 0,05 мкг) также тестировали на том же геле. Затем белки электроблоттировали на поливинилидендифторидную (ПВДФ) мембрану (GE Healthcare, США) с использованием полусухого трансблоттера (Biorad, США).Затем мембрану инкубировали в течение 2 ч в блокирующем растворе (5% масс./об. обезжиренного молока (Difco, США) в трис-буферном солевом растворе (TBS; 20 мМ Трис-HCl-буфер (pH 7,6), содержащий 137 мМ NaCl). три последовательных отмывки ТБС, мембрану зондировали конъюгатом Penta·His-HRP (Qiagen, США) в течение 2 ч с использованием 5% обезжиренного молока в ТБС, затем блот трижды промывали ТБСТ (ТБС, содержащий 0,05% об. /vol) Tween-20) Затем сигналы проявляли с помощью набора Supersignal West Femto (Thermo Scientific, США) в соответствии с протоколом, предложенным производителем, и регистрировали с помощью системы LAS 200 (GE Healthcare, США).

      Иммуноокрашивание и конфокальная микроскопия

      Для проверки клеток HeLa на предмет каких-либо морфологических изменений, вызванных воздействием MV, были приготовлены конфлюэнтные монослои на покровных стеклах с камерами Labtek™ II (Nunc, Германия). Перед обработкой, , т.е. ., добавлением MV, клетки HeLa голодали по сыворотке в течение не менее 20 часов. Затем клетки обрабатывали очищенными MV в течение 12 часов, затем промывали DPBS и фиксировали 3,7% параформальдегидом (в PBS) в течение 20 минут при комнатной температуре.После фиксации клетки промывали DPBS и пермеабилизировали 0,1% Triton X-100 (Sigma Aldrich, США) в DPBS в течение 5 мин. Затем актиновый цитоскелет окрашивали раствором фаллоидин-родамина (0,5 мкг/мл в DPBS; Invitrogen, США) в течение 30 мин при комнатной температуре. После повторной промывки клеток DPBS клеточную ДНК докрашивали DAPI (1 мкг/мл в PBS) (Life Technologies, США) в течение 5 мин при комнатной температуре. Затем эти клетки визуализировали с помощью лазерного конфокального микроскопа LSM 780 (Carl Zeiss, Германия) и полученные изображения обрабатывали с помощью программного обеспечения Zen 2009.

      Количественная оценка многоядерности

      Для определения степени многоядерности клетки HeLa высевали в 96-луночные планшеты для тканевых культур (10000 клеток/лунку) (Corning, США) и инкубировали в течение 24 часов с 5% CO 2 . Затем клетки инкубировали с различными концентрациями либо MV, либо очищенного CNFy в течение 48 ч при 5% CO 2 . После этой стадии инкубации клетки промывали DPBS (Sigma-Aldrich, США) и фиксировали 3,7% параформальдегидом (в PBS) в течение 10 мин при комнатной температуре.После трехкратного промывания фиксированных клеток DPBS их докрашивали DAPI (1 мкг/мл в PBS) (Life Technologies, США) в течение 5 мин при комнатной температуре. Затем клетки визуализировали с помощью лазерного конфокального микроскопа LSM 780 (Carl Zeiss, Германия) и полученные изображения обрабатывали с помощью программного обеспечения Zen 2009. Количество многоядерных клеток на конфокальных изображениях подсчитывали визуально и использовали для расчета процента.

      Визуализация МВ, ассоциированных с клетками HeLa

      МВ были очищены из культур Y.pseudotuberculosis ATCC 29833 и YPIII, как описано выше, а затем метили хлоридом октадецил родамина B (R18) (0,5 мкг/мл в DPBS; Invitrogen, США) в течение 20 мин. После окрашивания любой несвязавшийся краситель удаляли ультрацентрифугированием при 40 000 об/мин в течение 2 часов. Монослои клеток HeLa готовили в 8-луночных покровных стеклянных планшетах Nunc Lab-Tek II (Thermo Scientific, США) путем посева 2 × 10 4 клеток HeLa на лунку и инкубации их в инкубаторе СО 2 при 37°С. С в течение 24 часов.Для начала эксперимента в лунки добавляли 0,5 мл окрашенных родамином BR-18 MV (10 мкг/мл в MEM) и планшет инкубировали в течение 2 ч при 37°C, после чего клетки HeLa промывали DPBS. Затем клетки фиксировали 3,7% параформальдегидом (в PBS) в течение 20 мин при комнатной температуре, промывали PBS и пермеабилизировали раствором 0,1% Triton X-100 (Sigma Aldrich, США) в PBS в течение 5 мин.

      Для визуализации клеток HeLa актиновый цитоскелет окрашивали фаллоидином Alexa Fluor 488 (0.5 мкг/мл в DPBS; Thermo Scientific, США) в течение 30 мин при комнатной температуре. После промывки клеток DPBS клеточную ДНК докрашивали DAPI (1 мкг/мл в PBS; Thermo Scientific, США) в течение 5  мин при комнатной температуре. Затем клетки и МВ визуализировали с помощью лазерного конфокального микроскопа (LSM 780; Carl-Zeiss, Германия). Изображения обрабатывали с помощью программного обеспечения Zen (Carl-Zeiss, Германия).

      Анализ жизнеспособности клеток

      Влияние MV на жизнеспособность культивируемых клеток HeLa определяли с помощью анализа МТТ в соответствии с протоколом, предложенным производителем.Вкратце, 1 × 10 4 клеток высевали в лунки 96-луночного планшета и выращивали в течение 24 часов. Затем клетки подвергали воздействию MV от Y. pseudotuberculosis ATCC 29833 или YPIII путем замены среды в лунках свежей средой, содержащей MV. Клетки выращивали еще 24 часа в присутствии МВ. Затем в каждую лунку добавляли 5 мкг/мл 3-(4,5-диметил-2-тиазолил)-2,5-дифенил-2Н-тетразолийбромида (реактив МТТ, Life Technologies, США) и планшеты инкубировали при в течение дополнительных 4  часов при 37 °C в темноте.После тщательного удаления среды в каждую лунку добавляли 400 мкл ДМСО и планшет инкубировали при встряхивании (150 об/мин) при комнатной температуре в течение 15 минут для развития окраски. OD измеряли при 550 нм и использовали в качестве показателя жизнеспособности клеток HeLa.

      Визуализация живых/мертвых клеток

      Живые и мертвые клетки метили двумя красителями, кальцеином АМ и гомодимером этидия-1 (EthD-1) соответственно. Для этого культуры клеток HeLa готовили путем посева 1 × 10 4 клеток/лунку в 96-луночные планшеты и выращивали, как описано выше.

    Добавить комментарий

    Ваш адрес email не будет опубликован.