Регулон от прыщей: регулон от прыщей — 25 рекомендаций на Babyblog.ru

Содержание

регулон от прыщей — 25 рекомендаций на Babyblog.ru

Гепарин – Конечно же, использование гепарина при беременности должно осуществляться только под постоянным врачебным надзором. К тому же, если лечение длительное, то Вам следует периодически сдавать анализ крови. Обязательно следует контролировать свертываемость крови время от времени. Согласно врачебным нормам, один раз в два дня Вы должны сдавать кровь на анализ свертываемости. Если лечение гепарином продлилось дольше недели, то далее следует сдавать кровь на анализ один раз в три дня. Необходимо знать, что резко прекращать лечение гепарином нельзя. Это может сильно повредить Вашему здоровью. Следует постепенно снижать дозировку, заменяя гепарин на иные препараты.

Насколько опасен пародонтит? – Пародонтит представляет собой воспалительное заболевание десен, которое очень опасно при беременности. Опасность его заключается в том, что данный недуг может передаться малышу, который находится в утробе матери. Инфицирование пародонтитом может спровоцировать развитие у ребенка различных нарушений в работе желудочно-кишечного тракта. Клиническими исследованиями доказано еще и то, что у детей, чьи мамы во время беременности болели пародонтитом, чаще всего очень слабая иммунная система. В результате, они очень часто болеют различными воспалительными и инфекционными заболеваниями. Более того, пародонтит при беременности может стать причиной выкидыша. Очень важно, чтобы женщина избавилась от пародонтита еще до родов. А еще лучше, чтобы она вообще никогда не болела данным заболеванием. Именно поэтому каждой женщине нужно стараться вести здоровый образ жизни, соблюдать гигиену ротовой полости, а также принимать для профилактики различных заболеваний ротовой полости специальные БАД (биологически активные добавки).

Цитрамон во время беременности – Как ни странно, но связано это с аспирином, к которому мы привыкли относиться почти как к витамину или таблеткам заменителя сахара. На самом деле благодаря наличию аспирина цитрамон и является опасным для развития Вашего будущего ребенка. Больше того, цитрамон запрещено употреблять весь период кормления грудью. А для маленьких детей он также очень опасен. Под влиянием цитрамона (то есть содержащегося в нем аспирина) у малышей может развиться синдром Рейля, называемый еще «синдромом мертвого пальца». При этой загадочной болезни один или два пальца на руке вдруг резко бледнеют, синеют и теряют подвижность. Приступ может длиться до часа. Если синдром Рейля проявляется часто, то может привести к нарушению кровообращения в пальце и даже к гангрене. Иногда синдром Рейля поражает даже все пальцы на руке или всю стопу ноги. Вот такие неприятные последствия возможны у Вашего малыша от простого аспирина или цитрамона. Поэтому до двенадцати лет ни в коем случае не давайте ребенку цитрамон. А некоторые источники рекомендуют не лечить детей цитрамоном и до восемнадцати лет.

Диспепсия – Если говорить на чистоту, то до сих пор никто точно не знает, что именно вызывает тошноту и рвоту в данный период. Однако врачи чаще всего списывают эти симптомы на изменение гормонального фона. К другим причинам возникновения диспепсии у беременных можно отнести наличие у женщин таких заболеваний как: сахарный диабет и заболевания щитовидной железы. Если до беременности Вы пользовались какими-либо противозачаточными препаратами, тогда риск развития у Вас диспепсии увеличивается как минимум в два раза. Диспепсия может возникнуть и в результате наследственной предрасположенности. Как мы уже говорили, диспепсия при беременности чаще всего не несет никакой опасности. Именно поэтому не стоит сразу же бежать к врачу. Постарайтесь сами решить имеющуюся проблему. Для этого прибегните к помощи диетических мероприятий.

Витрум для беременных – Давайте разберемся в пользе витамина А. Данный витамин также входит в состав комплекса витрум. Данный витамин не только участвует в синтезе липидов, белков, полисахаридов и других веществ, но также помогает развитию органов зрения и нормализует работу кожного покрова. Витамин В – еще один составляющий компонент витрума, который предотвращает развитие токсикоза. В случае если у женщины наблюдается очень сильный токсикоз, тогда витрум поможет снизить его проявления до минимума. Витамин Е в свою очередь принимает участие в нормализации процесса кровообращения. Итак, попробуем объединить действия всех компонентов витрума и понять, для чего все же нужен данный комплекс витаминов и минералов. Дорогие будущие мамочки, принимая витрум, Вы можете быть спокойны как за свое здоровье и общее самочувствие, так и за рост и развитие Вашего малыша.

Виферон при беременности – Секрет виферона в том, что основным действующим компонентом его является вещество, которое вырабатывается человеческим организмом. Но для более успешной борьбы с болезнью весьма полезно ввести в организм дополнительное количество этого вещества. В составе виферона свечей присутствует интерферон рекомбинантный альфа-b, а также витамин С, ацетат токоферола и масло какао как основа свечей. В составе веферона – мази кроме основного активного компонента – интерферона, присутствует также ацетат токоферола, ланолин и вазелин. Как видите, состав препаратов виферон совершенно безобиден. Теперь подробнее о применении и действии виферона.

Магнезия – Сернокислая магнезия используется для инъекций в мышцу. При этом одна инъекция включает двадцать миллилитров жидкой магнезии в концентрации двадцать пять процентов. Инъекции магнезии выполняются от двух до четырех раз в день, в зависимости от тяжести состояния женщины. Так, при первой степени нефропатии магнезия беременной женщине вводится дважды в сутки, а при второй степени инъекция магнезии проводится уже четыре раза в день. Для того чтобы в месте укола не отмирали ткани, не было покраснения и воспаления, такие уколы делаются только специально подготовленным персоналом. Магнезия вводится только длинными иглами. Вводить магнезию беременной женщине нужно глубоко в мышцу, не спеша. Жидкую магнезию перед уколом немного согревают. Очень важно не допустить попадания инфекции при выполнении укола магнезии беременной женщине.

Снотворные при беременности – Данные препараты могут быть назначены беременной женщине только врачом, причем в очень редких случаях. Однако не стоит отчаиваться раньше времени. Не надо забывать, что эффект снотворных препаратов может быть заменен некоторыми правилами поведения беременной женщины. Соблюдая их, каждая беременная женщина сможет наслаждаться спокойным сном. В первую очередь, беременная женщина должна следить за тем, чтобы она постоянно оставалась спокойной по отношению ко всему происходящему. Ни в коем случае нельзя ложиться спать на обед. На ужин не стоит потреблять тяжелую пищу. Также нужно стараться с приходом вечера расслабляться – можно принять ванну, посмотреть расслабляющую передачу и так далее и тому подобное.

Гестоз беременных – Начало процесса, то есть гестоза, заложено в сужении кровеносных сосудов. При этом во время гестоза сосуды сужаются не в каких-то отдельных органах и не на определенный срок. Сужаются совершенно все кровеносные пути женского организма.
Чем опасно такое сужение сосудов?
Да все очень просто! Практически все органы и системы начинают страдать от недостатка кислорода, ведь именно кровь доставляет кислород от легких к периферическим органам и частям тела. Конечно же, наряду со всем женским организмом страдает и система воспроизводства. А кислород сейчас так нужен маленькому организму, развивающемуся в мамином животике!

Тироксин – в период беременности в организм женщины должно поступать такое количество йода, которого будет достаточно не только для усиленной работы щитовидной железы матери, но и для нормального функционирования щитовидной железы ребенка. Обеспечить щитовидную железу достаточным количеством йода удается, конечно же, не всегда. В результате о себе дают знать такие заболевания щитовидной железы как: гипотиреоз, тиреотоксикоз, диффузный токсический зоб, аутоиммунный тиреоидит и некоторые другие йододефицитные заболевания. Сразу же обратим внимание будущих мамочек на то, что данные заболевания щитовидной железы могут стать даже причиной выкидыша, гибели ребенка в утробе либо рождения малыша с недоразвитыми органами и системами. Чтобы этого избежать заболевания щитовидной железы должна быть подвергнуты лечению.

Парацетамол при беременности – К его помощи Вы можете обратиться в любую минуту. Данный лекарственный препарат рекомендован к использованию даже во время беременности. Прежде всего, он поможет Вам избавиться от головной боли, которая так часто сопровождает все вирусные и простудные заболевания. Парацетамол прекрасно справляется и с повышенной температурой тела, что также немаловажно. Избавившись от температуры, Вы почувствуете себя намного легче. Данное лекарственное средство относится к негормональным противовоспалительным препаратам. Более того, оно оказывает лечебное воздействие за весьма короткий промежуток времени, так что Вам не придется ждать вечность, чтобы забыть о болевых ощущениях.

Индометацин при беременности – Любой специалист скажет Вам о том, что индометацин в период беременности опасен. В очень редких случаях его могут назначить женщине в период первого либо второго триместра беременности и то только в том случае, если предполагаемая польза для матери значительно превышает потенциальный риск для плода. Воздействуя на плод в утробе матери, особенно в третьем триместре беременности, данный лекарственный препарат может стать причиной внутриутробного закрытия артериального протока, легочной гипертензии, а также недостаточности трехстворчатого клапана.

Синдром Дауна – Выявить синдром Дауна на раннем сроке беременности можно и при помощи определения размера воротничковой зоны плода за счет ультразвука. Дело в том, что, начиная с одиннадцатой недели беременности, в случае наличия у ребенка синдрома Дауна в задней части его шеи начинает накапливаться подкожная жидкость. При помощи ультразвука можно выявить наличие данной жидкости. Следует отметить, что данный метод диагностики синдрома Дауна еще не изучен до конца, так что стопроцентной гарантии он не дает.

Диазолин при беременности – Кроме употребления диазолина, исключите из своего рациона все продукты, которые могут спровоцировать аллергию. Это ненатуральные продукты, в составе которых много пищевых добавок, цитрусы, рыбные деликатесы, консервы, шоколад, куриные яйца, мед. Раз в неделю делайте разгрузочный день на кефире или на яблоках, или на вареной курице. Это поможет немного очистить организм и снизить основные проявления аллергии. Четко придерживайтесь распорядка питания, не ешьте на ночь.

Лейкоплакия и беременность – Лейкоплакией именуют фоновое заболевание шейки матки, сопровождающееся возникновением на наружных половых органах и влагалищной части шейки матки беловатых пятен. Обращаем Ваше внимание на то, что данные пятна невозможно снять ватным тампоном, так что даже не старайтесь. Представители современной медицины убеждены в том, что лейкоплакия шейки матки может стать причиной развития ракового заболевания. В большинстве случае данный недуг никак не беспокоит женщин. Именно поэтому обнаружить его удается только во время очередного посещения гинеколога. Что же делать, если в такой важный период жизни у Вас вдруг выявили лейкоплакию шейки матки?

Аскариды при беременности – Всем глистам данной группы свойственно размножаться половым путем. Половой акт осуществляется посредством специального кольцевого углубления, которое носит название перетяжка. Данное углубление находится на границе между передней и средней третях тела самки аскариды. Развивается личинка данного паразита на протяжении десяти – четырнадцати дней. Что же касается ее развития до взрослой особи, то данный период может затянуться до двух месяцев. Живут аскариды не более одного года.

Озонотерапия при беременности – Озонотерапия необходима беременным женщинам и в том случае, когда они находятся на грани выкидыша. Курс терапии данным лекарственным препаратом поможет сохранить Ваше положение. Более того, озон благотворно воздействует и на кровоток в плаценте, что в свою очередь помогает ребенку справиться с последствиями угрожающего выкидыша. Озонотерапия нашла свое широкое применение и в борьбе с гестозами беременных женщин. Обусловлено это тем, что озон обладает достаточно мощным антитоксическим и антибактериальным действием. Следует отметить еще и то, что при помощи озонотерапии можно снизить до минимума вероятность развития слабой родовой деятельности при родах. Будущим мамам известен тот факт, что достаточный доступ кислорода плоду во время родов очень важен. Ну, так вот, озонотерапия может это гарантировать.

Успокоительные при беременности – Для начала о тех успокоительных средствах, которые разрешено принимать в положении. Большинство современных успокоительных препаратов, созданных на основе растительного сырья, разрешено употреблять в ключевой период. К подобным средствам относятся валериана и пустырник в виде таблеток, спиртовых настоек. Кроме этого, разрешено использовать такие препараты, как Ново-Пассит.
В основе Ново-Пассита лежат растительные экстракты. Этот препарат поможет снять психическое напряжение, расслабит мускулатуру, нормализует работу сердечной мышцы. Выпускается Ново-Пассит в виде жидкости и таблеток. Осторожно следует принимать Ново-Пассит тем пациенткам, которые страдают повышенной чувствительностью к составляющим препарата. Не бегите за Ново-Пасситом тотчас, как дочитаете эту статью. Перед этим проконсультируйтесь с лечащим врачом. Возможно, в Вашем случае можно обойтись иными средствами.

Новокаин при беременности – Имейте в виду, что использование новокаина может вызвать побочные эффекты. Такие, как высыпания на коже и иные аллергические проявления, а также нарушение координации, резкое снижение давления, вялость. Если Вам делают инъекции с новокаином, проследите, чтобы место инъекции не протирали препаратами, в состав которых входят свинец или иные тяжелые металлы. Сочетание новокаина с тяжелыми металлами может вызвать воспаление в месте укола.
При лечении новокаином во время беременности никогда не превышайте указанных врачом дозировок. Передозировка может очень негативно сказаться на течении беременности и состоянии плода. Кроме того, при передозировке возможна рвота, нарушение сердечного ритма, побледнение лица, появление пота на лице и теле.

Кашель при беременности – Еще отличное средство от кашля при беременности – это обычный репчатый лук. Можно его измельчить, добавить немного меда и дать постоять. Полученный сок принимать по чайной ложке трижды в день. А можно сварить из лука сироп. Для этого берется одна луковица (не маленькая), заливается водой с добавлением двух столовых ложек сахара. Варите луковицу на огне полчаса. Огонь сделайте маленький. Дайте постоять, луковицу вытащите, и выбросьте, а сироп пейте по чайной ложке до пяти раз в сутки до принятия пищи.

Тиреоидит и беременность – Эти данные говорят о том, что тиреоидит может оказывать определенное негативное действие на ход беременности. Однако не спешите пугаться. Для начала нужно точно поставить диагноз. Простого ощупывания щитовидной железы в данном случае совершенно не достаточно. Дело в том, что во время беременности функции щитовидной железы и ее качество несколько изменяется. Поэтому пальпация не дает объективной картины. Вам обязательно должны назначить анализ крови на уровень антител. Кроме этого обязательно пройдите ультразвуковое обследование щитовидной железы. Если щитовидная железа по размеру больше нормы, да к тому же и анализ крови дает положительные результаты, тогда следует задуматься над лечением.

Признаки беременности – Вы подозреваете, что это уже произошло, но не уверены до конца? Приблизительно через неделю-полторы после оплодотворения эмбрион прикрепляется к стенке матки. Этот процесс нередко вызывает появление мажущих выделений и даже болей в низу живота.

Ранняя беременность – Когда это явление можно назвать ранним? С какими проблемами может столкнуться юная будущая мамочка? И как помочь ей выносить и родить здорового малыша?

Беременность и компьютер – На сегодняшний день, в принципе, не существует прямых доказательств того факта, что компьютер как таковой каким-то пагубным образом может повлиять на течение данного периода жизни женщины. Действие электроники на женщину в положении и развитие плода также мало изучено и пока непонятно, как и действие мобильных телефонов, краски для волос или употребления клонированной картошки. Пока по поводу всех этих факторов есть лишь предположения, домыслы, слухи. Но нет ни одного исследования, проведенного официально.

Лечение простуды при беременности – Самый первый и обычный спутник любой простуды – это насморк. Если нос сильно заложен и трудно дышать, используйте сосудосуживающие капли. Только не переусердствуйте. Эти препараты нельзя применять дольше трех дней. Замечательно помогают капли для лечения насморка, составленные из лекарственных трав. Перед использованием такого средства промойте нос раствором морской соли или физраствором. Для облегчения дыхания можно использовать вьетнамский бальзам «Звездочка» или мазь «Доктор МОМ». Эти препараты действуют практически одинаково. Намажьте бальзамом крылья носа, виски. Это поможет облегчить и головную боль. Далее можете использовать все средства народной медицины, кроме, конечно же, парения ног. Эта процедура категорически запрещена. На ноги можно надеть теплые шерстяные носки.

Беременность и секс – Знаете ли Вы, что по опросам ученых женщины во время беременности получают от секса в два раза меньше удовольствия, чем раньше? При этом почти треть женщин на сроках от шести месяцев и выше вообще не хотят заниматься сексом. А десять процентов опрошенных на весь этот период завязывают с сексом.

УЗИ плода – На сроке тридцати четырех недель проводится УЗИ плода, которое называется допплерометрия. Это обследование дает возможность оценить питание плода. В этот период, когда идет бурное развитие и рост малыша, ему как никогда нужно полноценное питание. Оно осуществляется, конечно же, через кровь. Допплерометрия позволяет оценить состояние кровеносных сосудов и выявить случаи кислородного голодания ребенка. К тому же на этом сроке можно точно определить, как будет расположен малыш во время родов. Иногда, если врач сомневается в нормальном течении беременности, Вам могут назначить дополнительные ультразвуковые обследования.

Тест на беременность – Последние несколько дней Вы неважно себя чувствуете? Совсем нет аппетита? Да ко всему прочему еще и задержка менструации? Вам пора в аптеку за тестомь. Тест на беременность – это замечательное изобретение. Плюсов у использования этого приспособление масса: Вы узнаете радостную новость не в кресле у ненавистного врача, а у себя дома. Иногда для того, чтобы осознать все как следует необходимо некоторое время и одиночество.

Беременность и бандаж. Сохраним красоту и здоровье – Врачи придумали много разных приспособлений для того, чтобы женщине в положении было как можно легче и чтобы после родов женщина быстрее пришла в форму. Одним из подобных полезных изобретений являются бандажи. Этот предмет женского белья постоянно претерпевает изменения, направленные на то, чтобы эффективность его использования совмещалась с удобством.

Герпес в период беременности – Вирусом герпеса сегодня заражены девяносто процентов взрослого населения. В связи с этим глупо думать, что как раз Вас-то это не коснется. Если Вы собираетесь в ближайшем будущем рожать малыша, узнайте поподробнее о том, каким образом герпес может повлиять на течение этого ответственного периода и как обезопасить себя и будущего ребенка.

Пиелонефрит при беременности – В положении женщины нередко заболевают пиелонефритом. Как выносить малыша и не заболеть этим неприятным недугом, и почему именно беременные женщины больше подвержены этому заболеванию? Во время беременности пиелонефрит развивается чаще по двум причинам. Во-первых, хуже выводится моча, во-вторых, в организме есть инфекция, провоцирующая воспаление.

Беременность и вегетарианство – Приверженцев вегетарианского образа питания становится в нашем обществе все больше. Люди отказываются от пищи животного происхождения по разным причинам. Нет единого мнения по поводу вегетарианства и у врачей. Однако по поводу вегетарианства и беременности все врачи единодушны. Выбирая такой образ питания, женщина должна четко отдавать себе отчет в том, что существуют вещества, которых нет в растительной пище.

Гемоглобин будущей мамы – Допустимая норма гемоглобина во время беременности составляет сто десять грамм на литр. Однако очень часто случается так, что именно во время беременности гемоглобин у женщин очень резко падает. Причиной тому нехватка железа. Дело в том, что в нормальном состоянии человеку достаточно потреблять от пяти до десяти миллиграмм железа в день. Количество потребляемого железа беременной женщиной должно составлять пятнадцать – восемнадцать миллиграмм. Дорогие будущие мамочки, количество гемоглобина в данный период Вашей жизни очень важно. Его низкий уровень может стать причиной выкидыша, задержки роста плода, а также развития проблем со здоровьем малыша.

Нистатин при беременности – Если кандидоз очень мучает Вас в первые три месяца беременности, то лечиться можно только народными методами. Никакие лекарственные средства использовать не разрешено. Вы можете обрабатывать влагалище зеленкой. Этот простой и доступный метод совершенно безопасен для эмбриона. Зеленка уменьшит воспаление слизистой оболочки, обрабатывая половые органы тампоном с зеленкой, Вы частично уничтожите возбудителей, а оставшиеся уже не смогут так активно размножаться. Облегчится общее состояние, уменьшится зуд. Процедуру следует проводить перед сном.

Тиреотоксикоз и беременность – Чтобы выявить тиреотоксикоз при беременности, женщине необходимо будет сдать ряд анализов. Результаты данных анализов, а также некоторые клинические данные помогут установить, есть у беременной женщины тиреотоксикоз или его нет. Как правило, гипертиреоз при беременности не требует особого лечения. Чаще всего данное заболевание проходит само собой. В большинстве случаев уже к последнему месяцу беременности от тиреотоксикоза не остается и следа.
Однако есть и одно но. Всем тиреостатикам свойственно проникать через плаценту. Следовательно, они могут негативно воздействовать и на щитовидную железу плода, который находится в утробе матери. Чтобы этого не допустить, беременной женщине назначают специальные лекарственные препараты. Правильное лечение поможет предупредить развитие тиреотоксикоза у плода. Согласно статистическим данным, положительный результат такого лечения отмечается в девяноста процентах случаев из ста.

Фестал при беременности – Знакомо ли Вам неприятное ощущение, когда невозможно вдохнуть от того, что желудок полон. Иногда переедание может вызвать повышенное газообразование. Это явление просто ужасно во время беременности. Фестал эффективно и быстро поможет Вам справиться с несварением желудка, вызванным, как употреблением не сочетаемых продуктов, так и перееданием. Показан фестал и в том случае, когда Ваша поджелудочная железа не может справиться со своей работой из-за каких-либо заболеваний. Употребление фестала улучшает усвоение организмом таких жизненно важных витаминов, как А, Е и К. Можно принимать фестал и во время кормления малыша грудью.

Состояние кожи при беременности – Изменения в состоянии кожных покровов в положении замечают все женщины. У кого-то эти изменения происходят в большей степени, а у кого-то в меньшей. Наиболее заметно состояние кожи меняется во вторые три месяца данного периода.

Беременность и водные процедуры – Большинство людей любят посещать бассейн или пляж. Вода расслабляет, снимает напряженность, помогает отвлечься от повседневных проблем. Плавание и упражнения в бассейне полезны даже тем людям, которым не рекомендуется заниматься физкультурой. Что же говорить о пользе водных процедур для женщин в положении. Нет ни одного доктора, который не советовал бы своим беременным пациенткам посещать бассейн. Даже при гипертонусе мускулатуры матки вода поможет снять напряженность.

Живот во время беременности – Если Вы впервые в положении, то живот появится немного позже и увеличиваться будет не так быстро. Связано это с тем, что мускулатура еще крепка и не растянута. Но обычно к началу четвертого месяца уже немного виден округлившийся животик. К седьмому месяцу беременности живот примет довольно внушительные размеры и будет доставлять некоторые неудобства.

Фибромиома матки и беременность – В первые три месяца фибромиома может быть опасной в том случае, если она расположена в области плаценты или если фибромиома матки велика. Если же величина узлов небольшая, то это может вообще никак не сказаться на течении процесса развития плода.

Реланиум при беременности – Если у беременной женщины обнаружена отслойка плаценты, это тоже очень серьезное нарушение течения беременности, при котором используется реланиум. Вводится реланиум внутримышечно в количестве двадцати миллиграммов трижды в день. Использование реланиума в таких случаях производится курсом вплоть до родов.
Применяется реланиум при беременности и в случае преждевременных родов. Внутримышечно вводятся двадцать миллиграммов реланиума, затем через 60 минут еще столько же.
Во время родов иногда применяют реланиум для облегчения процесса. Вводится реланиум тогда, когда шейка матки раскрыта на два пальца в количестве двадцати миллиграммов внутримышечно.

Пустырник при беременности – Очень распространенное явление во время беременности – это гипертонус матки. Используется пустырник и при гипертонусе матки. Назначается растение в виде отвара. В комплексные меры по расслаблению матки кроме пустырника входит и применение свечей с папаверином, а также таблетки но-шпы.
Во время беременности предпочтительнее использовать все-таки натуральные препараты, без каких-либо добавок. Поэтому отдайте предпочтение пустырнику в пакетиках для заваривания. Такие пакетики без труда можно найти в любой аптеке. Заваривайте по одному пакетику на стакан воды и принимайте натощак.
Между прочим, некоторые врачи рекомендуют заваривать себе чай из пустырника на протяжении всей беременности. Такой препарат не только успокоит Вас и прогонит прочь плохие мысли, но и улучшит сон, а также и кровообращение. Кровообращение очень важно для хорошего самочувствия и Вашего, и малыша.

Цефтриаксон при беременности – Почему именно цефтриаксон? Дело в том, что данный антибиотический препарат способен избавить беременную женщину от любого заболевания мочеполовой системы не только за короткий промежуток времени, но еще и с минимальным количеством побочных эффектов. Использование цефтриаксона также способно предупредить развитие огромного количества осложнений. В случае если у беременной женщины уретрит, проктит либо фарингит, тогда цефтриаксон будет назначен ей внутримышечно в количестве двухсот пятидесяти миллиграмм. Если же в наличии имеется гонококковый сепсис, тогда данный антибиотик вводится беременной женщине внутривенно либо внутримышечно в количестве одного грамма. Курс лечения данным препаратом составляет семь – десять дней, после чего женщине нужно будет сдать повторные посевы

Марвелон и беременность – По данным производителя, беременность после отмены марвелона может наступить сразу же. Но согласно медицинской статистике, чаще всего это происходит месяца через три, а то и через пол года. Это вполне нормальное явление. Все время, пока Вы принимали марвелон, в Вашем организме ни разу не было овуляции. Кроме этого, слизь, вырабатываемая половыми органами под воздействием марвелона, обладала несколько иными физическими свойствами. Организму необходимо время для восстановления нормальных функций.

Имодиум – Производитель уверяет нас, что при клинических и лабораторных испытаниях имодиума, не были выявлены какие-либо вредные последствия на развивающийся плод. Имодиум не может вызвать мутации в генах малыша, а также не является опасным ядовитым веществом. Но при этом, производитель предупреждает Вас, не следует принимать имодиум во втором и третьем триместре беременности без консультации врача. Причем взвесить ситуацию и принять решение о приеме имодиума во время беременности может только специалист. Именно он может оценить пользу от препарата и риск, которому Вы подвергаетесь. Из чего вывод: не занимайтесь самолечением, особенно во время беременности. Не забывайте, что на Вас лежит ответственность за здоровье малыша.

Использование фиалки – Любая женщина, тем более, если она беременная, мечтает быть красивой и привлекательной. На протяжении всей жизни женщина обращается за помощью к многочисленным косметическим средствам, чтобы добиться нужного ей результата. Период беременности – является одним из тех моментов в ее жизни, когда выбор косметических средств должен быть тщательно обдуман. А средства по уходу за собой во время беременности действительно необходимы. Ведь именно в этот промежуток времени о себе дают знать пигментные пятна, растяжки, прыщи, угри и так далее. Все это связано с изменением гормонального фона в организме женщины.

Геделикс – В составе сиропа геделикс присутствует экстракт плюща, который и является главным активным компонентом. Кроме него в сиропе есть анисовое масло, раствор сорбитола, глицерол, пропиленгликоль, макрогола глицерилгидроксистеарат и специально подготовленная вода. Состав капель геделикс попроще, в него входят только экстракт плюща, пропиленгликоль, глицерол, ароматизатор и мятное масло. В составе препаратов геделикс нет ни искусственных красителей, ни спирта, ни консервантов, ни каких-либо опасных для организма химических веществ. Это, практически, натуральный продукт. Как Вы уже поняли, геделикс не содержит и сахара. Это дает возможность принимать его тем беременным женщинам, которые страдают сахарным диабетом.

Шиповник – Шиповник – настоящая кладовая витаминов. Особенно богат он витамином С. Содержание в ягодах шиповника витамина С в пятьдесят раз превышает его содержание в таком рекордсмене, как лимон. Зрелые ягоды шиповника появляются к середине и концу осени. Как раз тогда, когда организм любого человека, а тем более беременной женщины, сталкивается с сезонными простудами и вирусами. Каждая будущая мамочка знает, что во время беременности иммунные силы организма работают в несколько ослабленном режиме. Связано это, конечно же, с тем, что все основные резервы идут на рост и развитие малютки.
Поэтому любые возможности для укрепления иммунитета во время беременности нужно использовать. Шиповник – это одна из таких возможностей. К тому же это достаточно приятно. Заварить чаек из шиповника, посидеть с ароматной кружкой у окна, за которым идет серый осенний дождь – это ли не удовольствие.

Регулон – Вы принимаете регулон и планируете вскоре стать мамой? У Вас есть сомнения в безопасности регулона для будущего малыша и Вашего здоровья? Если эти и другие подобные вопросы мучают Вас, дочитайте нашу статью.
Вот нашла вторую часть!!! ОООЧЕНЬ интересно!!!!

Папаверин – Папаверин при беременности применяют при гипертонусе матки. Это неприятное состояние, к сожалению, совсем не редкость для нынешних беременных женщин. Кроме этого, папаверин улучшает кровоснабжение мускулатуры матки, что весьма положительно влияет на состояние плода. Если у Вас есть угроза выкидыша, то Вам может помочь папаверин. Проконсультируйтесь по поводу этого препарата со своим лечащим врачом.

Иммунал – Производитель не дает данных о вредном влиянии иммунала на организм плода или будущей мамы. Но, тем не менее, в инструкции существует предупреждение о том, что без консультации с врачом, иммунал не следует применять, ни во время беременности, ни во время кормления грудью. Возможно, это связано с тем, что в составе иммунала – капель присутствует спирт. Хотя спирта совсем немного, это вещество никак не назовешь полезным для развивающегося организма малыша.
Может быть, опасения производителя связаны с аллергическими реакциями, которые могут возникнуть у беременных женщин при употреблении иммунала. В состав таблеток иммунал входят некоторые добавки, которые теоретически могут вызвать подобные реакции. Это вишневый и ванильный ароматизаторы, сахарин.

Регулон при прыщах — Вопрос дерматологу

Если вы не нашли нужной информации среди ответов на этот вопрос, или же ваша проблема немного отличается от представленной, попробуйте задать дополнительный вопрос врачу на этой же странице, если он будет по теме основного вопроса. Вы также можете задать новый вопрос, и через некоторое время наши врачи на него ответят. Это бесплатно. Также можете поискать нужную информацию в похожих вопросах на этой странице или через страницу поиска по сайту. Мы будем очень благодарны, если Вы порекомендуете нас своим друзьям в социальных сетях.

Медпортал 03online.com осуществляет медконсультации в режиме переписки с врачами на сайте. Здесь вы получаете ответы от реальных практикующих специалистов в своей области. В настоящий момент на сайте можно получить консультацию по 74 направлениям: специалиста COVID-19, аллерголога, анестезиолога-реаниматолога, венеролога, гастроэнтеролога, гематолога, генетика, гепатолога, гериатра, гинеколога, гинеколога-эндокринолога, гомеопата, дерматолога, детского гастроэнтеролога, детского гинеколога, детского дерматолога, детского инфекциониста, детского кардиолога, детского лора, детского невролога, детского нефролога, детского онколога, детского офтальмолога, детского психолога, детского пульмонолога, детского ревматолога, детского уролога, детского хирурга, детского эндокринолога, дефектолога, диетолога, иммунолога, инфекциониста, кардиолога, клинического психолога, косметолога, липидолога, логопеда, лора, маммолога, медицинского юриста, нарколога, невропатолога, нейрохирурга, неонатолога, нефролога, нутрициолога, онколога, онкоуролога, ортопеда-травматолога, офтальмолога, паразитолога, педиатра, пластического хирурга, подолога, проктолога, психиатра, психолога, пульмонолога, ревматолога, рентгенолога, репродуктолога, сексолога-андролога, стоматолога, трихолога, уролога, фармацевта, физиотерапевта, фитотерапевта, флеболога, фтизиатра, хирурга, эндокринолога.

Мы отвечаем на 97.44% вопросов.

Оставайтесь с нами и будьте здоровы!

Спираль или противозачаточные таблетки: что лучше?

В современном мире велик выбор всего и вся, в том числе и контрацептивов. Причем каждый производитель нахваливает свое средство защиты, подчеркивая обычно лишь преимущества и умалчивая о недостатках.

Самостоятельно разобраться в таком потоке разнообразной и порой противоречивой информации довольно сложно, однако в данной статье мы постараемся объективно осветить все плюсы и минусы основных средств контрацепции.

Для начала стоит отметить, что методов контрацепции довольно много, но всего лишь 2 из них применяются для долгосрочной защиты от беременности: внутриматочные спирали и гормональные контрацептивы.

Внутриматочные спирали: преимущества и недостатки

Внутриматочные спирали бывают:

  • гормональные
  • негормональные

Гормональные спирали обладают всеми преимуществами и недостатками негормональных спиралей и, кроме того, включают преимущества и недостатки гормональных средств контрацепции.

Гормональная внутриматочная спираль заслуживает отдельного рассмотрения.

В этой статье подробно рассмотрим принципы работы, преимущества и недостатки лишь негормональных спиралей.

Негормональные внутриматочные спирали: механизмы действия

Механизмы действия спирали:

  1. спираль влияет на состав цервикальной слизи, делаю ее более густой, что затрудняет продвижение сперматозоидов внутрь матки
  2. воздействует на сами сперматозоиды, уменьшая их подвижность
  3. усиливает перистальтику маточных труб (т.е. ускоряет продвижение яйцеклетки по трубам), и при ускоренном продвижении яйцеклетка выходит в матку, не успевая созреть. Несозревшая яйцеклетка не способна имплантироваться (встроиться) в матку.
  4. если оплодотворение все же произошло, то препятствует оплодотворенной яйцеклетке прикрепиться к стенкам матки

Последнее свойство позволяет использовать внутриматочную спираль, как

средство экстренной контрацепции, что намного безопаснее для организма, чем применение специальных таблеток экстренной контрацепции, содержащих большие дозы гормонов.

Преимущества внутриматочных негормональных спиралей

  1. Высокая степень защиты – выше 95%
  2. Могут служить средством экстренной контрацепции (однако необходимо установить ее е позднее 120 часов (5 дней) после незащищенного полового акта)
  3. Долгий срок службы от 3 до 10 лет в зависимости от состава спирали
  4. Наступление беременности возможно сразу после удаления спирали
  5. Не влияет на гормональный фон женщины (отсутствуют такие проблемы, как снижение либидо, нарушение менструального цикла, аменорея, болезненность молочных желез, перемена настроения, депрессии, головная боль, тошнота, присущие гормональным препаратам)
  6. Подходит в период лактации (кормящим матерям)
  7. Мгновенная эффективность (начинает работать сразу после введения)
  8. Подходит женщинам при некоторых заболеваниях, когда противопоказаны гормональные контрацептивы

Недостатки внутриматочных негормональных спиралей

  1. Введение и извлечение возможно только гинекологом
  2. Необходимо проверять наличие нитей спирали во влагалище после каждой менструации, чтобы вовремя заметить самопроизвольное выпадение спирали (случается довольно редко)
  3. Более обильные и продолжительные месячные в первые несколько месяцев после установки спирали
  4. Возможно развитие эндометриоза органов малого таза (редко)
  5. Увеличение риска развития воспалительных заболеваний матки и придатков
  6. Установка спирали не рекомендуется нерожавшим женщинам

Противопоказания для установки спирали

  1. беременность
  2. воспалительные заболевания органов малого таза
  3. злокачественные образования в шейке матки или теле матки
  4. кровотечения неустановленной этиологии (не установлена причина возникновения)
  5. деформация полости матки по разным причинам

Противозачаточные таблетки: преимущества и недостатки

Противозачаточные таблетки (оральные контрацептивы) – наиболее распространенный метод гормональной контрацепции.

В оральных контрацептивам используются синтетические гормоны, аналогичные по действию вырабатываемым самим организмом.

В состав противозачаточных таблеток в обязательном порядке входит гормон гестаген, который обеспечивает защиту от наступления беременности.

По составу оральные контрацептивы делятся на:

  • гестагенные (содержат только гормон гестаген)
  • комбинированные (содержат два гормона: гестаген и эстроген (нужен для контроля менструального цикла))

Принципы действия оральных контрацептивов

Противозачаточные таблетки:

  1. подавляют или тормозят овуляцию
  2. влияют на состав цервикальной слизи шейки матки, делая ее более вязкой и густой, которая препятствует прохождению сперматозоидов в матку
  3. воздействует на эндометрий (слизистую оболочку) матки так, что оплодотворенное яйцо не может закрепиться в нем
  4. гестагенные таблетки дополнительно уменьшают подвижность маточных труб, что замедляет продвижение яйцеклетки по ним и, как следствие, вероятность того, что сперматозоид успеет произвести оплодотворение, падает

Преимущества противозачаточных таблеток

  1. Высокая степень защиты – до 99% при правильном применении
  2. Возможность забеременеть в следующий цикл после отмены оральных контрацептивов, однако перед беременностью рекомендуется выждать 3 месяца
  3. Возможно применение нерожавшими женщинами
  4. Могут использоваться
    для лечения гормональных сбоев и некоторых гинекологических заболеваний

Недостатки противозачаточных таблеток

Многие недостатки оральных контрацептивов вытекают из их принципа действия:

  1. перепады настроения
  2. тошнота, иногда рвота
  3. болезненность молочных желез
  4. прибавка веса (может быть вызвана задержкой жидкости или изменением углеводно-жировом обмене)
  5. снижение либидо
  6. усиление акне (довольно редко)
  7. повышенный вывод микроэлементов из организма. При нехватке микроэлементов в организме, могут возникнуть серьезные заболевания. При приеме оральных контрацептивов важно принимать комплексы витаминов.
  8. ухудшение усвояемости глюкозы
    (встречается редко)
  9. головные боли
  10. мажущие выделения (особенно характерно для оральных контрацептивов с одним гормоном гестагеном)
  11. гормон эстроген в составе комбинированных противозачаточных таблеток повышает свертываемость крови (гиперкоагуляцию), что приводит к неприятным последствия: увеличивается риск тромбофлебита, инфаркта, инсульта, усугубляются имеющиеся сердечно-сосудистые проблемы.
  12. необходимость принимать таблетки в одно и тоже время по строго установленной схеме, иначе риск забеременеть резко возрастает
  13. для избежания негативных последствий назначать противозачаточные таблетки должен гинеколог после проведения всех необходимых исследований

В зависимости от типа гестагена (в фармацевтике используется около десятка различных гестагенов) и от наличия или отсутствия эстрогенов (обычно используется этинилэстрадиол) в составе орального контрацептивам могут наблюдаться различные побочные эффекты.

Перечень всех побочных эффектов указан в инструкциях к таблеткам.

Противопоказания к использованию противозачаточных таблеток

  1. беременность
  2. наличие злокачественных опухолей
  3. тромбозы или тромбоэмболии – возникновение тромбов в сосудах
  4. перенесенные инфаркты, инсульты
  5. нарушения свертываемости крови
  6. сердечно-сосудистые заболевания
  7. сахарный диабет
  8. заболевания печени
  9. курение
  10. послеродовой период менее 6 месяцев

Вывод

Применение противозачаточных таблеток требует повышенной ответственности и самоорганизации, ведь эффективность этого метода зависит от регулярности приема.

Контрацептивный эффект наступает не сразу, а в течении недели после начала приема.

Оральные контрацептивы воздействуют на гормональный фон, что ведет к появлению как просто неприятных, так и опасных побочных эффектов. Однако могут использоваться при лечении некоторых гинекологических заболеваний.

Внутриматочные спирали не влияют на гормональный фон женщины, их контрацептивный эффект основан на физических свойствах компонентов и проявляется сразу после установки.

Возможно спонтанное выпадение спирали, поэтому необходимо проверять наличие нитей спирали во влагалище. Также довольно часто наблюдается усиление менструальных выделений в первые месяцы после установки. Помимо этого внутриматочные спирали повышают риск развития воспалительных процессов.

Оба метода контрацепции имеют высокую эффективность.

Установку и извлечение спирали проводит гинеколог. Через некоторое время требуется повторный осмотр, и, если ничего не беспокоит, дальнейшее наблюдение у гинеколога необязательно.

Подбор и назначение противозачаточных таблеток должно проводится только гинекологом. Неправильно подобранные таблетки могут привести к серьезным побочным эффектам. Желательно постоянно мониторить состояние организма, чтобы своевременно выявить недостаток микроэлементов или развитие сопутствующих заболеваний и скорректировать их негативные проявления.

Будьте всегда здоровы! Ваш Медицинский Центр «36и6»!

Мифы и легенды о гормональной контрацепции Medical On Group Санкт-Петербург

1. От гормонов поправляются
Многие женщины верят в этот стереотип, сложившийся еще в 60-х годах ХХ века, когда появились первые гормональные контрацептивы. Тогда они содержали высокую концентрацию гормонов, а их прием действительно сопровождался увеличением массы тела. Сегодня дозы гормонов значительно снижены при сохранении контрацептивной эффективности; кроме того, ряд препаратов приобрели дополнительные полезные свойства. КОК последних поколений не повышают массу тела (при сохранении вашего пищевого рациона и физической активности), а некоторые средства с даже уменьшают ее.

2. КОК провоцируют гирсутизм (избыточный рост волос)
Этот побочный эффект был характерен для КОК первых поколений и связан с андрогенными свойствами гестагенов (повышенным влиянием мужских гормонов). Современные препараты, напротив, имеют антиандрогенные свойства, что снижает рост волос, жирность кожи и используется в лечении акне.
3. КОК вызывают бесплодие и после их применения долгое время невозможно забеременеть
Действие КОК прекращается сразу после отмены препарата. 20% беременностей наступает в течение первого цикла после отмены КОК, у 80% в течение 1 года, такие же цифры характерны для женщин, не применявших гормональные контрацептивы. Существует Ребаунд-эффект (в переводе с английского — имеющий обратное действие) — при применении КОК в течение 3х месяцев, на отмену возникает стимуляция овуляции, что в ряде случаев способствует наступлению долгожданной беременности.
4. КОК сохраняют яичниковый резерв (количество яйцеклеток)
Во время приема контрацептивов яичники не прекращают работать. В каждом яичнике каждый месяц продолжает зреть около 10-15 фолликулов, однако под действием гормонов происходит блокада овуляции (основной механизм контрацепции). Поэтому, если вы еще долгое время не планируете беременность стоит посмотреть ваш запас яйцеклеток, для этого перед применением КОК стоит сдать кровь на АМГ (Антимюллеров гормон).
5. КОК увеличивают риск тромбозов
КОК повышают риск тромбозов, но незначительно. Суммарно из 10 000 женщин, принимающих КОК, тромбозы могут возникнуть в течение года у 3-9 (кстати, в общей популяции частота тоже не нулевая — рискуют 1-5 из 10 000 женщин). Гораздо серьезнее повышает опасность тромбозов курение, беременность и особенно послеродовый период, ожирение, эндокринные заболевания, повышенное давление, длительная иммобилизация, операции, а также наличие тромбогенных мутаций. С целью снижения данного риска пройдите обследование у врача, чтобы подобрать наиболее подходящий для вас препарат, так как КОК имеют разные риски в зависимости от дозы эстрогенов и вида гестагена. Важно исключить наличие тромбогенных мутаций и проверить уровень гомоцистеина.
6. В приеме КОК надо делать перерывы
На самом деле перерывы в приеме повышают риск тромбозов, так как организму снова приходится подстраиваться под новый гормональный фон. Этот риск сохраняется в первые 3 месяца. Длительность приема зависит только от вашей необходимости в надежной контрацепции. Также возможна отмена в связи с появлением противопоказаний к приему, поэтому проходите регулярные обследования у врача на фоне приема КОК, не реже 1 раза в год. Обследование включает: сбор жалоб, анамнеза, осмотр, в том числе на кресле и молочных желез, мазок на флору, онкоцитологию, УЗИ органов малого таза, узи/ маммографию молочных желез, биохимический анализ крови.
7. КОК снижают либидо
Либидо — половое влечение, зависит от многих факторов, в том числе психоэмоциональных, а также от уровня гормонов, прежде всего эстрогенов, тестостерона и пролактина. Применение КОК может снижать уровень тревоги в связи со снижением риска наступления незапланированной беременности, как метод надежной контрацепции, тем самым благотворно влияя на либидо. Однако следует учесть состав КОК, дозу эстрогенов, силу антиандрогенного эффекта гестагена, избирательность его действия (общее воздействие или только периферическое), а также возможное повышение пролактина при приеме оральных контрацептивов. В случае возникновения подобного побочного действия, обратитесь к врачу, для подбора оптимального препарата, например, с хлормадинонацетатом.
8. После отмены КОК происходит нарушение менструального цикла, выпадение волос, усугубляется проблема акне, менструации становятся болезненными
Гормональные контрацептивы ничего не лечат и не усугубляют, их действие прекращается сразу после отмены. На фоне приема гормонов в постоянной дозе каждый день, временно происходит выравнивание гормонального фона, менструальноподобная реакция случается регулярно в дни перерыва или приема безгормональных таблеток. При отмене препарата возвращается свой гормональный фон, а также могут проявиться скрытые проблемы, ранее не диагностированные или ранее отсутствующие. Поэтому, если вы имеете проблемы, пройдите обследование гормонального фона до приема КОК, а также после отмены, если ваш цикл не восстановился. Необходимо также следить за уровнем гомоцистеина и магния, так как на фоне приема КОК может нарушаться усвояемость витаминов группы В и магния.
9. Отмена КОК требует сложной схемы с постепенным снижением дозы
На самом деле прием КОК прекращают одномоментно, после окончания всех активных таблеток в упаковке. Действие КОК прекращается сразу после выведения гормонов из крови в течение 1-2 суток, поэтому в случае пропуска в приеме таблеток возможно наступление незапланированной беременности.
10. КОК повышают риск онкологии
Существуют доказательства значительного снижения риска рака яичников, матки и толстого кишечника при приеме КОК. Однако риск рака молочной железы повышается при длительном приеме высоких доз эстрогенов, а также стимуляции ранее существовавшего процесса. Есть данные повышающие риск рака шейки матки при наличии вируса папилломы человека 16 и 18 типов. Поэтому перед применением КОК и не менее 1 раза в год в обязательном порядке необходимо проведение УЗИ молочных желез (маммографии), онкоцитологии. Для расчета индивидуального риска онкологии пройдите генетическое исследование метаболизма эстрогенов, генов детоксикации, исследование на наличие мутаций BRCA, повышающих риск рака молочной железы и яичников.

Автор статьи:

Другие статьи этого автора (похожие статьи):

Понравился материал? поделись с друзьями!

Вернуться к списку статей

Так ли полезны и опасны противозачаточные таблетки, как принято считать

Что такое противозачаточные таблетки?

Противозачаточные таблетки — одно из самых эффективных средств контрацепции, действительно надёжное и доступное, известное уже много десятилетий. Это гормональные препараты, в которых содержатся прогестины или прогестины вместе с эстрогенами. Всё это аналоги женских гормонов. Прогестины подавляют овуляцию, без которой нельзя забеременеть.

Как они работают?

Чтобы женщина смогла забеременеть, ей нужна созревшая яйцеклетка. В первой половине менструального цикла под действием гормонов яйцеклетка созревает и попадает из яичников в маточную трубу. После этого — в теории — женская половая клетка должна встретиться со сперматозоидом и отправиться в матку, чтобы там прикрепиться к стенке органа. Для этого нужен прогестерон — гормон, который готовит матку. Если зачатия не случилось, уровень прогестерона падает и начинается кровотечение, с которого стартует новый цикл.

Всё это время уровень эстрогенов и прогестерона колеблется так, как надо для зачатия ребёнка.

Противозачаточные таблетки создают в организме свой гормональный фон.

При этом они подавляют овуляцию, то есть оплодотворяться просто нечему.

У таблеток есть и другие свойства, которые сопротивляются зачатию. Например, они делают слизь в шейке матки густой, чтобы сперматозоиды не могли добраться до яйцеклетки, а внутренний слой матки — тонким, чтобы у яйцеклетки не получилось к нему прикрепиться.

Какими бывают противозачаточные таблетки?

Есть два вида таблеток:

  1. Прогестиновые с эстрогенами, или комбинированные. Если эстрогенов много, они могут подавить овуляцию. Но в таких дозах у них масса побочных эффектов, поэтому сами по себе их не используют для контрацепции, а добавляют в пилюли для имитации полного цикла.
  2. Прогестиновые, которые называются мини-пили. Их назначают, когда нельзя использовать обычные таблетки: если женщина кормит грудью, болеет мигренями или у неё образуются тромбы в сосудах.

Говорят, у таких контрацептивов много побочек. Это правда?

Действительно, у противозачаточных таблеток внушительный список противопоказаний и побочных эффектов. Достаточно открыть инструкцию к любому такому препарату и убедиться в этом самостоятельно.

Существует четыре поколения оральных контрацептивов. Чем новее препарат, тем меньше там гормонов, а значит, и побочных эффектов.

К сожалению, многие гинекологи любят назначать старые препараты: такие таблетки дешевле и «проверены временем». Поэтому на всякий случай выясните у врача, к какому поколению относится лекарство, которое он выписывает, и можно ли найти более мягкое средство.

Не стесняйтесь спрашивать, почему гинеколог считает, что вам подойдут именно эти таблетки, чем они лучше аналогов.

И чем грозит приём контрацептивов?

Самые тяжёлые побочные эффекты, которые встречаются у оральных контрацептивов:

  1. Тромбозы. Существует множество исследований, которые показывают, что риск развития тромбоза на фоне приёма таблеток увеличивается .
  2. Сердечно-сосудистые заболевания.
  3. Глаукома.

Это редкие явления, которые встречались, когда оральные контрацептивы только появились и в них было много гормонов. Чаще появляется тошнота, головокружения, изменения настроения, прорывные кровотечения. Обычно симптомы проходят через пару месяцев, но о них надо рассказать врачу и, если нет динамики, поменять препарат.

Из-за противозачаточных таблеток увеличивается вес?

Точно никто не скажет, что будет именно с вашим весом. Разные исследования дают разную информацию, но показывают, что в целом женщины, которые принимают гормональные контрацептивы, немного полнеют.

Среднее увеличение веса при приёме мини-пили — не больше 2 кг в год. Впрочем, эти данные основаны не на самых точных исследованиях .

Разные типы гормональных контрацептивов примерно одинаково влияют на вес.

Они приводят к возникновению рака?

Некоторые исследования показывают, что оральные контрацептивы, особенно если долго их применять, наоборот, снижают риск заболеть раком яичников. У женщин, которые пьют противозачаточные таблетки больше пяти лет, риск заболеть этим типом рака на 50% ниже, чем у женщин, которые таблетки никогда не принимали .

А вот риск обнаружить у себя рак груди или шейки матки, а также новообразования в печени увеличивается, хоть и незначительно . В некоторых случаях (если принимать таблетки долго) такой динамики и вовсе не прослеживается.

Противозачаточные таблетки такие страшные.

Их вообще можно использовать?

Можно. Их придумали как раз для того, чтобы ими пользоваться. Конечно, если нет противопоказаний.

Как уже говорилось, современные препараты становятся безопаснее, их проверяют всё тщательнее.

А что там с противопоказаниями?

У каждого препарата свой список, но есть общие противопоказания:

  1. Курение и возраст больше 35 лет (если вы не курите, возраст не считается).
  2. Склонность к образованию тромбов.
  3. Эстрогензависимые опухоли.
  4. Кровотечения из матки, причины которых не выяснены.
  5. Мигрени.
  6. Диабет с осложнениями со стороны сердца и сосудов.

Главное — не курить, если вы решили принимать оральные контрацептивы. Курение само по себе до добра не доводит, а в сочетании с гормональными контрацептивами увеличивает риск развития побочных эффектов.

Какие анализы надо сдать, чтобы получить рецепт?

Как правило, никакие. Гормональные контрацептивы для того и придумали, чтобы они были доступны, а тонны анализов эту самую доступность снижают.

На консультации врач в основном ориентируется на то, что рассказывает сама женщина о своём образе жизни, проблемах со здоровьем, о препаратах, которые постоянно принимает. Исходя из этого, он решает, какой прогестиновый компонент подойдёт больше, и назначает именно его.

Чтобы проверить, противопоказаны женщине таблетки или нет, действительно надо сдать ряд анализов.

Моя подруга принимала таблетки. Мне их тоже можно?

Ни в коем случае.

Назначить таблетки может только врач после консультации. Вдруг у вас есть противопоказания, которых нет у подруги, и вы в группе риска? Вдруг врач подруги назначил ей препарат старого поколения или подруга вообще купила лекарство по совету соседки?

Рисковать своим здоровьем будете вы, а не подруга. Не надо так.

Оральные контрацептивы позволяют яичникам отдохнуть?

Яичники не умеют отдыхать и уходить в отпуск, они работают большую часть жизни женщины, пока не наступит климакс.

Гормональные контрацептивы не устраивают каникулы для органов, а создают искусственный гормональный фон и подавляют овуляцию.

Это никак не связано с омоложением, долголетием и другими чудесными свойствами, которые любят приписывать гормонам.

Они нужны, чтобы выровнять цикл?

Гормональные контрацептивы создают собственный, особенный цикл. В нём не происходит главного — овуляции созревшей яйцеклетки. Менструации в этом случае приходят не потому, что яйцеклетка не оплодотворилась, а потому, что в приёме таблеток предусмотрен перерыв.

Такой искусственный цикл действительно ровный, переносится проще, поэтому оральные контрацептивы назначают, чтобы справиться с болезненными месячными.

После отмены препаратов вернётся ваш родной цикл. Каким он будет, зависит от множества факторов.

Противозачаточные таблетки помогут подготовиться к беременности?

Это контрацептивы. Они нужны, чтобы не забеременеть. Они не занимаются подготовкой к беременности.

Хотя в некоторые препараты добавляют фолиевую кислоту на случай, если вы решите отменить таблетки, сразу же забеременеть и обеспечить этим витамином будущего ребёнка.

А от прыщей помогут?

Могут помочь. Есть у гормональных средств такое действие, они помогают справиться с акне. Только всегда надо помнить, что эффект этот — дополнительный, побочный, никак не основной. Кроме того, иногда что-то идёт не так и прыщи, наоборот, появляются или становятся заметнее.

Как принимать, чтобы не навредить себе?

Все просто: принимайте только по назначению врача и строго по инструкции.

ОК: Диане-35, Жанин и др. [часть 2] — Страница 5 — Красота и здоровье

вам нужно почитать в нете инструкции. обычно там пишут надо ли делать перерыв, обычно как заканчиваешь ОК и если хочешь перейти на другие, то перерыв не делают. вы купите Джес и почитайте инструкцию, или в нете найдите.

Спасибо, читала. И, честно говоря, запуталась окончательно ))

В инструкциях по применению стандартно написано, что рекомендуется начать прием на следующий день после завершения курса предыдущего препарата.

Спасибо за отзыв

Я переходила именно с этих ОК, по совету гинеколога.
Как пришли месячные после Жанина, в тот же день начала Джесс. То есть в первый день цикла.


Запуталась я. Вот что пишет BAYER SCHERING PHARMA AG —
При переходе с других комбинированных пероральных контрацептивов, вагинального кольца или контрацептивного пластыря
Предпочтительно начать прием препарата на следующий день после приема последней активной таблетки из предыдущей упаковки, но ни в коем случае не позднее следующего дня после обычного 7-дневного перерыва (для препаратов, содержащих 21 таблетку) или после приема последней неактивной таблетки (для препаратов, содержащих 28 таблеток в упаковке). Прием препарата Джес следует начинать в день удаления вагинального кольца или пластыря, но не позднее дня, когда должно быть введено новое кольцо или наклеен новый пластырь.
Т.е. если я заканчиваю Жанин (21 джраже), то я делаю 7 днев. перерыв как обычно и начинаю Джес. А Вы прием начали в первы день месячн. Но у меня тут небольшая проблема. они Ооочнь скудные стали и порой не разберешь в какой именно день они начались

В любом случае, спасибо!

Противозачаточные от угрей: список препаратов, применение

Для лечения угревой сыпи применяются гормоны. Контрацептивы от прыщей помогают восстановить биохимический баланс в организме представительницы слабого пола. Кожные высыпания появляются на фоне гиперандрогении, снижения концентрации эстрогенов в крови, дисфункции желудочно-кишечного тракта и других нарушений. Поэтому, прежде чем назначать контрацептивы для лечения угревой сыпи, следует проконсультироваться у семейного доктора, который направит к узкому специалисту.

Акушер-гинеколог, кандидат медицинских наук Румянцева утверждает, что противозачаточные таблетки от прыщей действуют на первоисточник этой проблемы — увеличенный уровень мужских половых гормонов андрогенов в кровеносном русле. Они стимулируют выработку глобулина, связывающего тестостерон.

Зачем они нужны?

Гормональные таблетки от прыщей помогают в таких случаях:

  • Угревая сыпь невыясненной этиологии. Такой диагноз означает, что у женщины появляются прыщи на ровном месте, без параллельного воздействия экзогенных факторов.
  • От акне. Последние отличаются от угрей тем, что возникновение их связано с мультифокальный воспалением. Воспалительный процесс провоцируют вирусы, бактерии и другая патогенная микрофлора, персистирующая на поверхности кожи.
  • Прыщики. Это еще одна разновидность кожных артефактов, которые появляются при неправильной работе сальных желез. В последних возникает закупорка, застой содержимого и нагноение.
Вернуться к оглавлению

Как они работают?

Применение контрацептивов от прыщей у женщин способствует нормализации деятельности сальных и потовых желез.

Противозачаточные средства были изобретены и синтезированы фармацевтической промышленностью для регуляции женского цикла. Но они обладают не только контрацептивными свойствами. Эти лекарства способны делать кожу гладкой благодаря угнетению восприимчивости кожных рецепторов к андрогенам и тестостерону. ОК от прыщей создают в организме иллюзию, что женщина уже забеременела. Биохимическая перестройка, происходящая вслед за этим, улучшает волосы и ногти, а также отлично подходит для лечения акне. Нормализуя деятельность рецепторов, сальных и потовых желез, гормональная терапия производит революцию в организме. Но это влияние имеет ряд побочных эффектов, с которыми необходимо ознакомиться, прежде чем решиться на курс лечения.

Вернуться к оглавлению

Какие медикаменты нужны?

Лучшие антиандрогены от прыщей может подобрать лечащий доктор. Он учитывает сопутствующие заболевания женщины, ее возраст, конституцию, особенности метаболизма и гормональную панель. На основании полученных данных врач решает, лучше ли пить оральные контрацептивы, или все же ограничиться местной терапией, локально нормализующей функцию желез и рецепторов.

Вернуться к оглавлению

Список препаратов

Противозачаточные таблетки для лечения прыщей классифицируют на несколько групп, основываясь на фармакокинетике и фармакодинамике:

Одним из монофазных противозачаточных средств, которые используются при высыпаниях является Марвелон.
  • Монофазные. Эти антиандрогенные препараты для женщин действуют благодаря одинаковому количеству эстрогена и прогестерона в своем составе. К ним принадлежат «Мерсилон», «Логест», «Марвелон», «Ярина», «Регулон», «Жанин», «Микрогинон» и «Минизистон».
  • Двухфазные. Они содержат две разные комбинации эстрогенов и прогестинов. Эту группу считают промежуточной.
  • Трехфазные. Эти таблетки содержат соответственно 3 комбинации описанных выше гормонов в разных процентных соотношениях. Среди фармацевтических названий выделяют «3-Мерси», «Триквилар», «Три-Регол».
Вернуться к оглавлению

Применение КОК

Если появились прыщи, не следует сразу самостоятельно назначать себе, покупать и принимать оральную контрацепцию. Это может привести к нежелательным системным последствиям для организма. Женщинам, столкнувшимся с проблемной кожей, следует получить консультацию у гинеколога, дерматолога и гастроэнтеролога. Эти препараты применяются по строгим показаниям, поскольку являются биологически активными и оказывают воздействие на рецепторы в органах и системах.

Вернуться к оглавлению

Список противопоказаний

Гормональные препараты необходимо с осторожностью принимать следующим группам пациентов:

Беременным женщинам противопоказано употреблять медикаментозные препараты, так как они способны вызвать выкидыш.
  • Беременные. В этот период организм женщины полностью перестраивается. Даже самые незначительные воздействия биологически активных веществ на матку, яичники и другие органы может повлечь за собой такое негативное последствие, как внутриутробные дефекты развития плода или даже выкидыш.
  • Угревая сыпь иного происхождения. Если к кожным проявлениям привела дисфункция гастроинтестинальной системы, неправильно назначенное лечение может только усугубить ситуацию. Таких пациенток следует подготовить к строгой диете, комплексному обследованию с помощью эзофагогастродуоденоскопии и дальнейшей терапии у гастроэнтеролога.
  • Лактирующие мамы. Медикаменты способны проникать в грудное молоко, накапливаясь там в высоких концентрациях и поражая организм ребенка.
  • Пациентки с тяжелыми заболеваниями печени. К таковым относятся вирусные и метаболические гепатиты, цирроз.
  • Доброкачественные и злокачественные опухоли. Гормоны способны стимулировать развитие новообразований, их прогрессирование и метастазирование.
  • Тромбозы в анамнезе. Препараты стимулируют свертываемость крови и провоцируют образование закупорок в магистральных сосудах.
  • Высокое артериальное давление.
Вернуться к оглавлению

Побочные эффекты

Даже хорошие препараты имеют негативные последствия для организма, если их принимать бесконтрольно. К примеру, от «Визанны» могут появляться нерегулярные кровотечения из женских половых органов, дискомфорт в молочных железах и депрессивные состояния. От «Регулона» возникают такие побочные эффекты, как венозная тромбоэмболия, нарушения свертывающей и противосвертывающей систем крови. А вот от «Силуэта» появляются циркуляторные нарушения, ожирение и метаболический синдром. У некоторых женщин прыщи после отмены ОК рецидивируют. Но это наблюдается при угревых высыпаниях тяжелой степени, когда необходимо комплексное воздействие на внешние и внутренние механизмы заболевания.

Какие противозачаточные таблетки могут помочь уменьшить прыщи? — InformedHealth.org

Если девушки и женщины, страдающие акне, используют противозачаточные таблетки в качестве формы контрацепции, это также может положительно сказаться на их цвете лица. Различные типы таблеток могут помочь уменьшить прыщи. Между различными противозачаточными таблетками нет большой разницы.

Акне — наиболее распространенное заболевание кожи у подростков. У большинства мальчиков и девочек в период полового созревания в той или иной степени появляются прыщи. Ясно видимые стойкие прыщи могут быть очень неприятными для подростков и влиять на их самооценку.В результате многие мальчики и девочки пробуют всевозможные способы избавиться от прыщей.

Противозачаточные таблетки и акне

Основная причина развития акне заключается в том, что мужской половой гормон андроген вырабатывается в больших количествах в период полового созревания, в том числе и у девочек. Воспалительные и невоспалительные прыщи могут улучшиться у девочек и женщин, которые используют противозачаточные таблетки в качестве контроля над рождаемостью. Таблетки, которые помогают против прыщей, содержат женские половые гормоны эстроген и прогестин. Но большинство противозачаточных таблеток не были специально одобрены для лечения акне.Существуют также негормональные методы лечения акне, некоторые из которых имеют меньше побочных эффектов.

На частоту и тяжесть побочных эффектов влияет доза гормонов в противозачаточных таблетках. Но возможные побочные эффекты могут по-прежнему играть важную роль при принятии решения о том, какую таблетку использовать. Так что полезно знать, уменьшают ли одни таблетки прыщи более эффективно, чем другие, и какие побочные эффекты они имеют.

Исследования выявили лишь небольшие различия в воздействии на акне

Исследователи из Cochrane Collaboration – международной исследовательской сети – изучили эффективность противозачаточных таблеток при лечении акне.Они провели поиск исследований, сравнивающих таблетки с поддельным лекарством (плацебо) или негормональным лекарством от прыщей. Исследователи проанализировали 31 исследование с участием около 12 500 человек. В большинстве исследований различные противозачаточные таблетки сравнивали друг с другом или с плацебо. Вряд ли какие-либо исследования сравнивали таблетки с другими лекарствами от прыщей.

Все протестированные противозачаточные таблетки смогли улучшить состояние при угревой сыпи. Они уменьшили как воспалительные, так и невоспалительные угри. Таблетки часто приходилось принимать в течение нескольких недель или месяцев, прежде чем состояние кожи участников улучшалось.Противозачаточные таблетки, уменьшающие акне, содержали этинилэстрадиол в сочетании с одним из следующих препаратов: левоноргестрел, норэтиндрон, норгестимат, дроспиренон, ацетат ципротерона, ацетат хлормадинона, диеногест или дезогестрел.

Исследования показали, что большинство таблеток оказывали сходное положительное воздействие на акне. Некоторые лекарства показали себя немного лучше, чем другие в отдельных исследованиях. Но необходимы дальнейшие исследования, чтобы можно было сказать, действительно ли они более эффективны.В одном исследовании было обнаружено, что таблетки, содержащие ацетат ципротерона, помогают уменьшить прыщи несколько лучше, чем таблетки, содержащие левоноргестрел. Другое исследование показало, что таблетки, содержащие ацетат хлормадинона, более эффективны, чем таблетки с левоноргестрелом. Ципротерона ацетат не одобрен для контрацепции в Германии, но его можно назначать для лечения акне. Ни одно из других исследований не показало, что какие-либо таблетки лучше или хуже других. Таким образом, любые заявления о том, что определенные таблетки приведут к гораздо лучшему состоянию кожи, чем другие таблетки, следует принимать с осторожностью.

Риск тромбоза глубоких вен зависит от типа таблетки

Противозачаточные таблетки могут иметь побочные эффекты, такие как головные боли, болезненность молочных желез и тошнота. Некоторые женщины перестают принимать таблетки из-за этих проблем. Не было проведено достаточно исследований, чтобы сказать, возникают ли подобные побочные эффекты чаще при приеме одних таблеток, чем при приеме других.

Гормональные контрацептивы также повышают риск образования тромбов в ногах (тромбоз глубоких вен), даже если общий риск невелик.Противозачаточные таблетки третьего и четвертого поколения (например, содержащие дезогестрел, диеногест, гестоден и дроспиренон), по-видимому, увеличивают риск тромбоза больше, чем более старые таблетки первого и второго поколения (например, содержащие левоноргестрел или норгестимат). Подсчитано, что тромбоз возникает в течение одного года примерно у 9–12 из 10 000 женщин, которые регулярно принимают противозачаточные таблетки, содержащие дезогестрел, гестоден или дроспиренон.

  • от 5 до 7 из 10 000 женщин, которые регулярно принимают противозачаточные таблетки, содержащие левоноргестрел или норгестимат.

  • Для сравнения, тромбоз возникает примерно у 2 из 10 000 женщин, не принимающих противозачаточные таблетки.

    Тромбоз глубоких вен может вызывать болезненность, отек, ноющую боль в ногах, а иногда даже проблемы с кожей. В очень редких случаях это может привести к опасной для жизни закупорке легочной артерии (легочная эмболия).

    Источники

    • Медицинская информация IQWiG написана с целью помочь люди понимают преимущества и недостатки основных вариантов лечения и здоровья услуги по уходу.

      Поскольку IQWiG является немецким институтом, некоторая информация, представленная здесь, относится к Немецкая система здравоохранения. Пригодность любого из описанных вариантов у конкретного случае можно определить, поговорив с врачом. Мы не предлагаем индивидуальные консультации.

      Наша информация основана на результатах качественных исследований. Это написано команда медицинских работников, ученых и редакторов, а также проверенных внешними экспертами. Ты сможешь найти подробное описание того, как наша медицинская информация создается и обновляется в наши методы.

    Дезогестрел-этинилэстрадиол перорально: применение, побочные эффекты, взаимодействие, изображения, предупреждения и дозировка

    Прочтите информационный листок для пациентов, предоставленный вашим фармацевтом, прежде чем вы начнете использовать этот продукт и каждый раз, когда вы будете получать добавку. Листовка содержит очень важную информацию о том, когда принимать таблетки и что делать, если вы пропустите дозу. Если у вас есть какие-либо вопросы, обратитесь к своему врачу или фармацевту.

    Принимайте это лекарство внутрь по назначению врача, обычно один раз в день. Выберите время суток, которое вам легко запомнить, и принимайте таблетку каждый день в одно и то же время.

    Если вы принимаете жевательную таблетку, вы можете либо проглотить ее целиком, либо тщательно разжевать и проглотить. Внимательно следуйте инструкциям производителя для вашего бренда.

    Очень важно продолжать принимать это лекарство точно так, как это предписано врачом. При использовании некоторых марок противозачаточных таблеток количество эстрогена и прогестина в каждой активной таблетке будет варьироваться в разное время цикла.Очень важно, чтобы вы следовали инструкциям на упаковке, чтобы найти первую таблетку, начать с первой таблетки в упаковке и принимать их в правильном порядке. Не пропускайте ни одной дозы. Беременность более вероятна, если вы пропустите прием таблеток, поздно начнете новую упаковку или примете таблетку в другое время дня, чем обычно.

    Рвота или диарея могут помешать действию противозачаточных таблеток. Если у вас рвота или диарея, возможно, вам придется использовать резервный метод контрацепции (например, презервативы, спермициды). Следуйте указаниям в буклете с информацией для пациентов и обратитесь к своему врачу или фармацевту за более подробной информацией.

    Прием этого лекарства после ужина или перед сном может помочь, если у вас есть расстройство желудка или тошнота от лекарства. Вы можете принять это лекарство в другое время дня, которое вам легче запомнить. Независимо от того, какой график дозирования вы используете, очень важно принимать это лекарство в одно и то же время каждый день с интервалом в 24 часа. Спросите своего врача или фармацевта, если у вас есть какие-либо вопросы.

    Ваша упаковка содержит 21 таблетку с активным лекарством. Он также может содержать 7 таблеток-напоминаний без лекарств. Принимайте по одной активной таблетке (с гормонами) один раз в день в течение 21 дня подряд. Если вы используете продукт с 28 таблетками, принимайте неактивную таблетку один раз в день в течение 7 дней подряд после того, как вы приняли последнюю активную таблетку, если иное не предписано врачом. Если вы используете продукт с 21 таблеткой, не принимайте никаких таблеток в течение 7 дней, если иное не предписано врачом. Месячные должны быть на четвертой неделе цикла.После того, как вы приняли последнюю неактивную таблетку в упаковке или в течение 7 дней не принимали активную таблетку, на следующий день начните новую упаковку, независимо от того, есть ли у вас менструация. Если у вас нет менструации, обратитесь к врачу.

    Если вы впервые принимаете это лекарство и не переходите с другой формы гормональных противозачаточных средств (например, пластырей, других противозачаточных таблеток), примите первую таблетку в упаковке в первое воскресенье после начала лечения. менструального цикла или в первый день менструации.Если ваш период начинается в воскресенье, начните принимать это лекарство в этот день. Только для первого цикла использования используйте дополнительную форму негормонального контроля над рождаемостью (например, презервативы, спермициды) в течение первых 7 дней, чтобы предотвратить беременность, пока лекарство не подействует. Если вы начинаете в первый день менструации, вам не нужно использовать резервные противозачаточные средства в первую неделю.

    Спросите своего врача или фармацевта, как перейти с других форм гормональных противозачаточных средств (таких как пластырь, другие противозачаточные таблетки) на этот продукт.Если какая-либо информация неясна, обратитесь к Информационному листку для пациентов или к своему врачу или фармацевту.

    Различия, сходства и какой из них лучше для вас

    Обзор препаратов и основные отличия | Условия лечения | Эффективность | Страховое покрытие и сравнение стоимости | Побочные эффекты | Лекарственные взаимодействия | Предупреждения | Часто задаваемые вопросы

    Если вы женщина детородного возраста, возможно, вы сталкивались с несколькими вариантами предотвращения беременности. На рынке есть несколько противозачаточных таблеток.Из них Yaz и Yasmin представляют собой два комбинированных оральных контрацептива (КОК), которые имеют некоторые сходства и различия. В зависимости от вашей истории болезни и общего состояния здоровья одна противозачаточная таблетка может быть лучше, чем другие.

    И Yaz, и Yasmin производятся компанией Bayer HealthCare Pharmaceuticals и содержат этинилэстрадиол, эстроген, и дроспиренон, синтетическую форму прогестина. Комбинация этих двух гормонов предотвращает овуляцию (выход яйцеклетки из яичников), вызывая изменения во влагалище и матке.Эти изменения включают увеличение густоты вагинальной слизи, чтобы предотвратить попадание сперматозоидов в матку.

    Другие патентованные препараты, содержащие этинилэстрадиол и дроспиренон, включают Gianvi, Syeda, Nikki и Zarah.

    В чем основные отличия Яз от Ясмин?

    Яз (Купоны Яз) содержит 0,02 мг этинилэстрадиола и 3 мг дроспиренона. Он одобрен Управлением по санитарному надзору за качеством пищевых продуктов и медикаментов (FDA) для предотвращения беременности. Он также может лечить депрессию и аффективные симптомы предменструального дисфорического расстройства (ПМДР), а также умеренное акне у женщин в возрасте 14 лет и старше.В блистерной упаковке 21 активная таблетка и 7 неактивных, или плацебо, таблеток.

    Ясмин (купоны Ясмин) содержит 0,03 мг этинилэстрадиола и 3 мг дроспиренона. В отличие от Яз, Ясмин показан только для предотвращения беременности. В одном блистере 24 активных таблетки и 4 таблетки плацебо.

    Основные отличия Yaz от Yasmin
    Класс наркотиков Гормональный контрацептив
    Комбинированный оральный контрацептив
    Гормональный контрацептив
    Комбинированный оральный контрацептив
    Торговая марка/общий статус Доступна общая версия Доступна общая версия
    Какое общее название? Дроспиренон и этинилэстрадиол Дроспиренон и этинилэстрадиол
    В какой форме выпускается наркотик? Таблетка для приема внутрь Таблетка для приема внутрь
    Какова стандартная дозировка? 0.02 мг этинилэстрадиола / 3 мг дроспиренона 0,03 мг этинилэстрадиола/3 мг дроспиренона
    Какова продолжительность типичного лечения? 28-дневный цикл 28-дневный цикл
    Кто обычно использует лекарство? Для контрацепции: женщины репродуктивного возраста
    При умеренной форме акне: женщины старше 14 лет
    Для контрацепции: женщины репродуктивного возраста

    Хотите лучшую цену на Yaz?

    Подпишитесь на уведомления о ценах на Yaz и узнавайте, когда цена изменится!

    Получать оповещения о ценах

    Условия лечения Yaz и Yasmin

    И Яз, и Ясмин предотвращают беременность у женщин. В дополнение к контрацепции Yaz (что такое Yaz?) может лечить симптомы предменструального дисфорического расстройства (PMDD) у женщин, которые хотели бы использовать противозачаточные средства. Yaz также может лечить умеренные прыщи у женщин в возрасте 14 лет и старше.

    Используйте следующую таблицу, чтобы сравнить разрешенное медицинское использование и использование не по прямому назначению Yaz и Yasmin.

    Противозачаточные средства Да Да
    Предменструальное дисфорическое расстройство (ПМДР) Да
    Акне Да

    Яз или Ясмин более эффективны?

    И Яз, и Ясмин доказали свою эффективность в предотвращении беременности у женщин, не использующих другие средства контрацепции.

    В первичном исследовании для проверки эффективности Yaz частота наступления беременности составила 1 из 100 женщин в год. В этом исследовании приняли участие более тысячи участников, которые в совокупности завершили более десяти тысяч 28-дневных циклов. Исследование включало разнородную группу женщин и длилось 1 год.

    В исследованиях, оценивающих эффективность Ясмин (Что такое Ясмин?), частота наступления беременности составляла менее 1 на 100 женщин в год. Например, одно исследование показало, что частота наступления беременности составляет 0,407, что указывает на высокую эффективность.Все исследования эффективности длились до 2 лет и включали более двух тысяч участников, которые в совокупности завершили более тридцати тысяч 28-дневных циклов.

    Сравнение охвата и стоимости Yaz и Yasmin

    Yaz — это фирменный препарат, который может покрываться или не покрываться в зависимости от вашего страхового плана. Средняя розничная стоимость марки Yaz составляет 157 долларов за 28-дневную поставку.

    Loryna, Kyra и Nikki являются общими эквивалентами Yaz, которые имеют те же ингредиенты и могут стоить около 85 долларов. С купоном SingleCare вы можете снизить эту стоимость и ожидать, что заплатите около 25 долларов.

    Yasmin также является фирменным препаратом и может покрываться или не покрываться в зависимости от вашего плана страхования. Yasmin может стоить около 150 долларов за 28-дневный запас. Ocella, Syeda и Zarah являются непатентованными эквивалентами Yasmin, которые содержат идентичные ингредиенты в той же концентрации. Ocella стоит около 72 долларов. Если вы используете купон SingleCare Yasmin, вы можете сэкономить больше на этом препарате.

    Получите дисконтную карту рецептурных препаратов SingleCare

    Обычно покрывается страховкой?
    Обычно покрывается Medicare?
    Стандартная дозировка 0.02 мг этинилэстрадиола / 3 мг дроспиренона
    28-дневный запас
    0,03 мг этинилэстрадиола / 3 мг дроспиренона
    28-дневный курс
    Стандартная доплата Medicare Зависит от вашего страхового плана Зависит от вашего страхового плана
    Стоимость SingleCare 25 долларов 47 $

    Побочные эффекты Яз против Ясмин

    Yaz и Yasmin имеют некоторые схожие побочные эффекты, такие как головные боли или мигрени, тошнота, рвота, болезненность молочных желез и изменения настроения. Другие побочные эффекты Yaz включают менструальные изменения, раздражительность, снижение либидо (полового влечения) и увеличение веса. Другие побочные эффекты Ясмин включают предменструальный синдром (ПМС) и боль или дискомфорт в животе.

    Yaz и Yasmin также могут вызывать серьезные побочные эффекты, такие как образование тромбов, сердечный приступ и инсульт. Сгустки крови также могут вызывать другие серьезные осложнения, такие как тромбоэмболии, когда сгустки застревают в кровеносном сосуде. Тромбоэмболии могут включать легочную эмболию (ТЭЛА) в легких или тромбоз глубоких вен (ТГВ) в ногах.

    Высокое кровяное давление, проблемы с желчным пузырем и заболевания печени — это другие побочные эффекты, которые могут возникнуть при приеме противозачаточных таблеток. Эти эффекты могут быть опасными для жизни. Поговорите со своим врачом, если у вас уже есть высокое кровяное давление, проблемы со свертываемостью крови или опухоли печени в анамнезе, прежде чем начинать противозачаточные средства.

    Несмотря на то, что женщины, принимающие Яз или Ясмин, имеют повышенный риск образования тромбов, медицинские эксперты не рекомендуют немедленно прекращать их прием. Согласно одному отчету CMAJ, риск все еще относительно низок.Тем не менее, риск все еще существует, что привело к тому, что некоторые страны, такие как Франция, прекратили покрытие противозачаточных средств.

    Побочный эффект Применимо? Частота Применимо? Частота
    Головная боль/мигрень Да 7% Да 11%
    Нарушения менструального цикла Да 5%-25%
    Тошнота/рвота Да 4%-16% Да 5%
    Боль/болезненность груди Да 4% Да 8%
    Изменения настроения Да 2% Да 2%
    Раздражительность Да 3%
    Снижение либидо Да 3%
    Прибавка в весе Да 3%
    Предменструальный синдром Да 13%
    Боль в животе Да 2%

    Источник: DailyMed (Яз), DailyMed (Ясмин)

    Лекарственные взаимодействия Yaz vs.

    Ясмин

    Яз и Ясмин взаимодействуют с одними и теми же типами препаратов. Травяные продукты или лекарства, влияющие на ферменты печени, особенно на фермент CYP3A4, могут оказывать влияние на противозачаточные таблетки. Такие препараты, как фенитоин и карбамазепин, индуцируют фермент CYP3A4 и снижают эффективность противозачаточных таблеток. Ингибиторы фермента CYP3A4, такие как кетоконазол и дилтиазем, могут повышать уровень Yaz или Yasmin в организме.

    Другие лекарства, используемые для лечения ВИЧ, также могут влиять на уровень эстрогена и прогестина в организме.Эти уровни могут изменить эффективность противозачаточных таблеток. Хотя сообщалось, что антибиотики влияют на оральные контрацептивы, до сих пор ведутся споры о том, оказывают ли антибиотики значительное влияние на оральные контрацептивы. Большинство медицинских работников по-прежнему рекомендуют использовать резервный метод контрацепции, если вам прописали антибиотик.

    Индукторы CYP3A4 (фенитоин, карбамазепин, топирамат, рифампин, окскарбазепин, зверобой продырявленный и др. ) Да Да
    Ингибиторы CYP3A4 (кетоконазол, флуконазол, вориконазол, верапамил, макролиды, дилтиазем и др.) Да Да
    Лекарства от ВИЧ, такие как ингибиторы протеазы (атазанавир, ритонавир и т. д.) и ненуклеозидные ингибиторы обратной транскриптазы (невирапин, эфавиренз и этравирин и т. д.) Да Да
    Антибиотики Да Да

    Предупреждения Яз против Ясмин

    Поскольку и Yaz, и Yasmin содержат дроспиренон, они сопряжены с более высоким риском образования тромбов, которые могут привести к сердечно-сосудистым заболеваниям, таким как сердечный приступ и инсульт.Женщинам старше 35 лет, которые курят, не следует использовать Яз или Ясмин. Было показано, что курение сигарет увеличивает риск образования тромбов и побочных эффектов при использовании комбинированных пероральных контрацептивов.

    Yaz и Yasmin содержат дроспиренон, который может повышать уровень калия в организме. Эти таблетки могут увеличить риск гиперкалиемии или калия выше нормы. Таким образом, уровень калия следует контролировать у женщин, которые также принимают другие лекарства, которые могут повышать уровень калия.

    Женщины, у которых в анамнезе были рак груди, высокое кровяное давление, проблемы с печенью или почками, диабет и высокий уровень холестерина, должны проконсультироваться с врачом, прежде чем начинать принимать Yaz или Yasmin. Прием комбинированных оральных контрацептивов может усугубить эти проблемы или увеличить риск серьезных побочных эффектов.

    Yaz или Yasmin не следует использовать беременным женщинам или тем женщинам, которые подозревают, что они беременны. Если вы подозреваете, что беременны, принимая оральные контрацептивы, вам следует прекратить их использование.

    Часто задаваемые вопросы о Яз против Ясмин

    Что такое Яз?

    Яз представляет собой комбинированный оральный контрацептив (КОК). Он содержит 0,02 мг этинилэстрадиола и 3 мг дроспиренона. Яз не только предотвращает беременность, но также лечит предменструальное дисфорическое расстройство (ПМДР) и акне у женщин в возрасте 14 лет и старше.

    Что такое Ясмин?

    Yasmin похож на Yaz и содержит те же ингредиенты. Однако он содержит 0,03 мг этинилэстрадиола и 3 мг дроспиренона.Ясмин используется исключительно для предотвращения беременности у женщин детородного возраста.

    Яз и Ясмин одно и то же?

    Yaz и Yasmin содержат этинилэстрадиол и дроспиренон. Но это не одно и то же лекарство. Ясмин содержит несколько большее количество этинилэстрадиола по сравнению с Яз. Они также имеют различное применение и побочные эффекты.

    Яз или Ясмин лучше?

    Yas и Yasmin эффективны для предотвращения беременности. Согласно исследованиям эффективности, только около 1 из 100 женщин в год беременеют при приеме Яз или Ясмин.Тем не менее, некоторые женщины могут предпочесть один препарат другому из-за возможных побочных эффектов.

    Вызывает ли Яз увеличение веса?

    Да. Yaz может вызвать увеличение веса у некоторых женщин. По данным исследования женщин с предменструальным дисфорическим расстройством (ПМДР), около 2,5% женщин, принимавших йаз, имели прибавку в весе. Этого побочного эффекта может быть достаточно, чтобы некоторые женщины выбрали другую противозачаточную таблетку.

    Приводит ли Ясмин к увеличению веса?

    Прибавка в весе не является обычным побочным эффектом Yasmin.Хотя изменение веса может быть побочным эффектом противозачаточных таблеток в целом, вы, скорее всего, не наберете вес с Ясмин. Проконсультируйтесь с врачом, если у вас были проблемы с весом в прошлом.

    Белки теплового шока и воспалительные угри: молекулярное клонирование, сверхэкспрессия и очистка гомолога GroEL и DnaK Propionibacterium acnes | Письма FEMS по микробиологии

    Аннотация

    Propionibacterium acnes вызывает воспалительные угри.Гены, кодирующие два предполагаемых медиатора воспаления, белки теплового шока GroEL и DnaK, были клонированы из этого организма и секвенированы. groEL и dnaK кодируют белки с молекулярной массой 56,8 и 66,4 кДа соответственно, которые демонстрируют высокую степень гомологии (>75% сходства) с белками GroEL и DnaK микобактерий и стрептомицетов. Промоторные области обоих генов содержат последовательности инвертированных повторов, которые, как полагают, участвуют в регуляции транскрипции генов теплового шока.Рекомбинантный P.acnes GroEL и DnaK сверхэкспрессировали в Escherichia coli с С-концевыми гистидиновыми метками. Рекомбинантные белки очищали от E.coli с помощью металл-аффинной хроматографии. Эти белки теперь будут использоваться в иммунологических исследованиях для определения их роли в воспалительных акне.

    1 Введение

    Вульгарные угри — это заболевание сальных фолликулов, наиболее распространенное заболевание кожи, поражающее до 80% людей в какой-либо период их жизни [1]. Propionibacterium acnes ассоциируется с воспалительными угрями, поскольку антибактериальная терапия, снижающая количество микроорганизмов, приводит к клиническому улучшению заболевания, а неудача терапии связана с развитием антибиотикорезистентности у P. acnes [2,3]. Однако точная роль P. acnes в этом заболевании до сих пор неясна. Нет связи между плотностью популяции P. acnes и тяжестью акне [4] и попытками различения штаммов P.acnes от акне и кожи без акне оказались безуспешными [5]. Считается, что воспалительная стадия акне развивается после клеточно-опосредованного иммунного ответа на антиген(ы) P. acnes [6]. Однако антиген(ы), ответственные за эту воспалительную реакцию, неизвестны.

    Белки теплового шока (HSP) опосредуют правильный фолдинг вновь синтезированных белков. Синтез БТШ активируется после теплового шока, во время которого они предотвращают агрегацию денатурированных белков в клетке.Этот ответ наблюдался при большом количестве физиологических стрессов, включая изменения pH и напряжения кислорода, а также ограничение питательных веществ [7]. HSP обладают высокой иммуногенностью, а GroEL (HSP60) и DnaK (HSP70) были идентифицированы как основные мишени иммунного ответа на бактериальные патогены [8,9].

    Мы предполагаем, что P. acnes , колонизирующие определенные сальные фолликулы, могут испытывать физиологический стресс, например, изменение напряжения кислорода или ограничение питательных веществ. Организм может реагировать на этот стресс, усиливая синтез HSP, и именно на эти белки хозяин запускает воспалительный иммунный ответ, характерный для акне.Эта гипотеза объясняет, почему в любой момент времени поражается только определенное количество фолликулов. Чтобы провести иммунологические исследования для оценки роли БТШ P. acnes в обыкновенных угрях, эти белки должны быть идентифицированы и получены в достаточном количестве и с приемлемой чистотой. Здесь мы описываем идентификацию и клонирование гомолога P. acnes groEL и dnaK , их сверхэкспрессию в Escherichia coli и очистку рекомбинантных белков.

    2 Материалы и методы

    2.

    1 Бактериальные штаммы и условия культивирования

    E. coli обычно выращивали в аэробных условиях при 37°C на агаре LB или в бульоне LB с добавлением ампициллина (100 мкг мл -1 ) или канамицина (50 мкг мл -1 ), если это необходимо. Бактериофаг λ размножали в E. coli C600 по стандартным методикам [10]. Штамм AT1 P. acnes (выделенный из воспаленного очага у пациента, обратившегося в отделение дерматологии Главного госпиталя Лидса) выращивали при 34°C в атмосфере N 2 :CO 2 :H 2 (80:10:10 по т.) на усиленном клостридиальном агаре (Oxoid) или в 2% (масса/объем) триптоне, 1% (масса/объем) дрожжевого экстракта, 0,5% (масса/объем) глюкозы (бульон TYG).

    2.2 Манипуляции с ДНК

    Основные методики выполнялись, как описано в [10]. Экстракцию геномной ДНК P. acnes проводили, как описано ранее [11]. Нуклеотидные последовательности плазмидных вставок определяли для обеих цепей с помощью автоматического флуоресцентного секвенирования (ABI Prism, модель 373, версия 3. 0). Данные о последовательности ДНК анализировали с использованием программного обеспечения DNASIS (Hitachi).

    2.3 Клонирование

    P. acnes groEL и dnaK

    Фрагменты GroEL и DnaK были получены с использованием P. Acnes геномной ДНК в качестве матрицы в полимеразной цепной реакции (PCR,) с вырожденными олигонуклеотидными праймерами GGCGAATTCGTSCGNGTSACSCTNGGNCCN и GGCGAATTCSGCCTTNCGNCGRTCNCCRAA или GGCGAATTCGCSCTNGCSTAYGGNCTNGAY и GGCGAATTCRTCRAAVGTSACYTCRATYTG, соответственно, с 30 циклами 94 & deg; С в течение 1 мин, 55°С в течение 1 мин, 72°С в течение 1 мин.Библиотека геномной ДНК P. acnes в λ EMBL3 была сконструирована ранее (неопубликовано). Библиотеку λ засевали E. coli C600 и бляшки переносили на нейлоновую мембрану (Boehringer Mannheim) по стандартной методике [10]. В качестве зондов использовали ПЦР-амплифицированные фрагменты гена groEL и dnaK , меченные дигоксигенином (DIG, Boehringer Mannheim). Мембраны гибридизовали в течение 16 ч при 68°С. После промывки в жестких условиях (2×5 мин в 2×SSC/0,1% (вес/объем) SDS при комнатной температуре, 2×15 мин в 0.1×SSC/0,1% (масса/объем) SDS при 68°C) мембраны инкубировали со связанными с щелочной фосфатазой антителами против DIG в течение 20 минут при комнатной температуре. Мембраны промывали и инкубировали с раствором субстрата в темноте до 2 часов. ДНК из groEL — и dnaK -положительных λ-клонов экстрагировали и проводили саузерн-блоттинг с использованием зондов groEL и dnaK , соответственно, с использованием процедуры гибридизации, описанной выше. Фрагмент Sma I размером 3,5 т.п.н., содержащий groEL , и фрагмент Hin dIII размером 5 т.п.н., содержащий dnaK , были клонированы в pBluescript для создания плазмид pMF6002 и pMF7001, соответственно, и groEL и groEL и последовательно.

    2.

    4 Субклонирование groEL и dnaK в экспрессионные векторы

    groEL подвергали ПЦР-амплификации из pMF6002 с использованием праймеров GACAGATTCTATGGCAAAGCTCATCGAA и GATGCGGCCGCCATCATGCCGCCCAT с параметрами цикла, описанными выше. Продукт ПЦР расщепляли Bgl II, концы затупляли нуклеазой бобов мунг и расщепляли Not I. Его лигировали в pET-30b, который был расщеплен Nde I, концы затупляли нуклеазой бобов мунг. и расщепляли Not I с получением плазмиды pMF6004. dnaK подвергали ПЦР-амплификации из pMF7001 с использованием праймеров TATGGCCCGTTTCAGTCG и GATGCGGCCGCCTTTTTCTCGTCCTCGTCG и параметров цикла, описанных выше. Продукт ПЦР расщепляли Not I и лигировали в pET-30b, который расщепляли, как описано выше, для создания плазмиды pMF7002. Было проведено секвенирование, чтобы подтвердить, что гены находятся в рамке считывания с кодонами his-tag.

    2.

    5 Сверхэкспрессия и очистка рекомбинантного P.acnes GroEL и DnaK

    Экспрессионная плазмида (pMF6004 или pMF7002) трансформировалась в E.coli BL21(DE3) и клетки распределяли на агаре LB, содержащем канамицин (50 мкг мл -1 ). Одну колонию инокулировали в бульон LB, содержащий канамицин (50 мкг мл -1 ), и выращивали в аэробных условиях при 37°C до OD 600 0,6–0,8. Добавляли IPTG до конечной концентрации 1 мМ и продолжали инкубацию в течение 3 часов. Меченный His рекомбинантный белок очищали с использованием спин-колонок Ni 2+ -NTA (Qiagen). Клетки собирали и ресуспендировали в 0,1 об. 50 мМ фосфатно-натриевого буфера с рН 8.0,1 мМ NaCl, 20% (об./об.) глицерин (буфер А), содержащий 20 мМ имидазола. Лизоцим добавляли к 1 мг/мл -1 , клетки инкубировали на льду в течение 30 мин и лизировали встряхиванием. Нерастворимый материал удаляли центрифугированием (13000× g , 30 мин при 4°С) и клеточный лизат пропускали через спин-колонку. Колонки промывали последовательно буфером А с 20 мМ имидазолом, буфером А с 40 мМ имидазолом и буфером А с 60 мМ имидазолом. Белки элюировали с колонки 50 мМ натрий-фосфатным буфером с рН 8.0,1 мМ NaCl и 250 мМ имидазола. На заключительном этапе очистки очищенный на колонке GroEL центрифугировали (1000× g , 30 мин) через концентратор Centricon-100 (Amicon). Образцы белка разделяли с помощью SDS-PAGE с использованием 10% (масс./об.) SDS-полиакриламидных гелей, а затем окрашивали кумасси голубым или серебром (Bio-Rad). Для N-концевого секвенирования рекомбинантный P. acnes GroEL и DnaK разделяли с помощью SDS-PAGE и подвергали электроблотингу на поливинилидендифторидных мембранах с использованием полусухого электроблоттера.Белки идентифицировали путем окрашивания кумасси синим и секвенировали с помощью деградации по Эдману.

    3 Результаты и обсуждение

    3.

    1 Клонирование и секвенирование ДНК groEL и ПЦР

    с использованием вырожденных праймеров для амплификации фрагментов groEL и dnaK давала основные продукты длиной примерно 800 и 920 п.н. соответственно. Секвенирование этих фрагментов выявило высокую степень гомологии с генами groEL и dnaK других бактерий и содержание G+C (60.3 и 61,2% соответственно), аналогично другим генам P. acnes , что подтверждает, что они являются фрагментами гомологов P. acnes groEL и dnaK . Библиотеку P. acnes λ исследовали с помощью меченных DIG фрагментов groEL и dnaK . Были идентифицированы и выделены три groEL -положительных λ-клона (обозначенных λ groEL 1–3) и один dnaK -положительный λ-клон (обозначенный λ dnaK ). Фрагмент Sma I размером 3,5 т.п.н. из λ groEL 1 и фрагмент Hin dIII размером 5 т.п.о. из λ dnaK были идентифицированы как несущие гены groEL и dnaK соответственно.Эти фрагменты клонировали и секвенировали полные генов groEL и dnaK . Последовательность фрагментов со столелом от λ со столеной 3 2 и λ со всю цену 3 выявлена ​​одинаковыми последовательностями к тому, что λ со всю цена 1.

    3.2 Анализ нуклеотидной последовательности

    CREAL и DNAK

    Ген groEL имеет ORF 1632 п.н. с содержанием G+C 61,9%. Ген dnaK имеет ORF 1851 п.н. с содержанием G+C 62.0%. Предполагаемые промоторы обоих генов содержат последовательности, сходные с последовательностями E. coli -35, -10 и консенсусными последовательностями сайта связывания рибосом (рис. 1). Промотор groEL содержит две последовательности инвертированных повторов, сходные с регуляторными последовательностями CIRCE (controlling inverted Repeat of Chaperone Expression), обнаруженными у ряда других организмов [12]. Промотор dnaK содержит три последовательности инвертированных повторов. Они подобны регуляторным последовательностям HAIR (HspR-ассоциированный инвертированный повтор), которые были недавно идентифицированы у некоторых стрептомицетов и микобактерий [13,14].Ген groEL кодирует белок из 544 аминокислот с расчетной молекулярной массой 56,8 кДа. Этот белок демонстрирует высокую степень гомологии с белками GroEL других бактерий, особенно белков микобактерий (например, 59,0 и 78,8% идентичности с Mycobacterium tuberculosis GroEL1 и GroEL2 соответственно) и стрептомицетов (например, 68,2 и 81,8% идентичности с Streptomyces albus ). GroEL1 и GroEL2 соответственно). Кроме того, P. acnes GroEL обладает мотивом GGM на С-конце и мотивом YXXXXLXERXAKL, оба из которых обнаружены у многих других членов семейства GroEL [15,16].Не было обнаружено groES -подобного гена выше по течению от groEL , обнаруженного у других бактерий. Однако, как и другие члены группы грамположительных бактерий с высоким содержанием G+C, такие как микобактерии и стрептомицеты [17,18], P. acnes могут иметь второй ген groEL , который находится в опероне с groES. . Ген dnaK кодирует белок из 617 аминокислот с расчетной молекулярной массой 66,4 кДа. Как и в случае с GroEL, P. acnes DnaK проявляет значительную гомологию с белками DnaK микобактерий и стрептомицетов (e.г. 67,7 и 73,5% идентичности с M. tuberculosis DnaK и Streptomyces coelicolor DnaK соответственно).

    1

    Предполагаемые промоторные области P. acnes (A) groEL и (B) dnaK . Предполагаемые области -35, -10 и сайты связывания рибосом (RBS) заключены в рамки. Показаны первые два кодона открытой рамки считывания и соответствующие им аминокислоты. Две последовательности CIRCE в промоторе groEL и три HAIR-подобные последовательности в промоторе dnaK подчеркнуты стрелками.Полные нуклеотидные последовательности P. acnes groEL и dnaK были отправлены в базу данных GenBank, и им были присвоены номера доступа AF222061 и AF222062 соответственно.

    1

    Предполагаемые промоторные области P. acnes (A) groEL и (B) dnaK . Предполагаемые области -35, -10 и сайты связывания рибосом (RBS) заключены в рамки. Показаны первые два кодона открытой рамки считывания и соответствующие им аминокислоты.Две последовательности CIRCE в промоторе groEL и три HAIR-подобные последовательности в промоторе dnaK подчеркнуты стрелками. Полные нуклеотидные последовательности P. acnes groEL и dnaK были отправлены в базу данных GenBank, и им были присвоены номера доступа AF222061 и AF222062 соответственно.

    3.3 Сверхэкспрессия и очистка рекомбинантного

    P.acnes GroEL и DnaK

    Оба рекомбинантных белка сильно гиперэкспрессировались после индукции IPTG.Белок с более высокой молекулярной массой, совместно очищенный с GroEL (рис. 2а), который удаляли фильтрацией с исключением по размеру, чтобы получить очищенный GroEL (рис. 2b). Этот белок не был идентифицирован, но может принадлежать к семейству протеаз Clp, которые участвуют в деградации белков с неправильной укладкой после теплового шока и включают GroEL. DnaK очищали только Ni 2+ -хелатной хроматографией (рис. 3). Кажущаяся молекулярная масса обоих рекомбинантных белков, определенная с помощью SDS-PAGE, соответствовала молекулярным массам, предсказанным на основе аминокислотных последовательностей.Идентичность очищенного GroEL и DnaK была подтверждена N-концевым секвенированием.

    2

    10% (масса/объем) SDS-PAGE анализ образцов после очистки GroEL с помощью металлоаффинной хроматографии. GroEL с меткой His связывали с колонкой Ni-NTA, последовательно промывали 20, 40 и 60 мМ имидазолом и элюировали 250 мМ имидазолом. (A) Гель, окрашенный кумасси синим. Дорожка 1: маркеры молекулярной массы; дорожка 2: клеточный лизат; дорожка 3: несвязанный белок; дорожки 4–6: промывки; дорожки 7–9: элюции.Загрязнитель указан стрелкой. (B) Окрашенный серебром гель, показывающий удаление загрязнения. Дорожка 1: маркеры молекулярной массы; дорожка 2: фильтрат Центрикон-100; дорожка 3: ретентат Centricon-100. Загрязнитель указан стрелкой.

    2

    10% (масса/объем) SDS-PAGE анализ образцов после очистки GroEL с помощью металлоаффинной хроматографии. GroEL с меткой His связывали с колонкой Ni-NTA, последовательно промывали 20, 40 и 60 мМ имидазолом и элюировали 250 мМ имидазолом.(A) Гель, окрашенный кумасси синим. Дорожка 1: маркеры молекулярной массы; дорожка 2: клеточный лизат; дорожка 3: несвязанный белок; дорожки 4–6: промывки; дорожки 7–9: элюции. Загрязнитель указан стрелкой. (B) Окрашенный серебром гель, показывающий удаление загрязнения. Дорожка 1: маркеры молекулярной массы; дорожка 2: фильтрат Центрикон-100; дорожка 3: ретентат Centricon-100. Загрязнитель указан стрелкой.

    3

    Окрашенный кумасси синим 10% (масса/объем) SDS-полиакриламидный гель образцов после очистки ДНК методом аффинной хроматографии с металлами.Меченую His DnaK связывали с колонкой Ni-NTA, промывали последовательно 20 и 40 мМ имидазолом и элюировали 250 мМ имидазолом. Дорожка 1: маркеры молекулярной массы; дорожка 2: клеточный лизат; дорожка 3: несвязанный белок; дорожки 4 и 5: промывки; дорожки 6–8: элюции.

    3

    Окрашенный кумасси синим 10% (масса/объем) SDS-полиакриламидный гель образцов после очистки DnaK с помощью металлоаффинной хроматографии. Меченую His DnaK связывали с колонкой Ni-NTA, промывали последовательно 20 и 40 мМ имидазолом и элюировали 250 мМ имидазолом.Дорожка 1: маркеры молекулярной массы; дорожка 2: клеточный лизат; дорожка 3: несвязанный белок; дорожки 4 и 5: промывки; дорожки 6–8: элюции.

    Теперь можно будет оценить присутствие и локализацию P. acnes GroEL и DnaK в нормальной и воспаленной коже и, таким образом, инициировать проверку гипотезы о том, что эти белки участвуют в инициации воспаления при этом заболевании. .

    Благодарности

    Авторы благодарят Артура Мойра (кафедра молекулярной биологии Шеффилдского университета) за проведение секвенирования N-концевых аминокислот. Работа выполнена при финансовой поддержке Медицинского исследовательского совета.

    Каталожные номера

    [1]

    (

    1989

    )

    Акне

    ( Ред.).

    Мартин Дуниц

    ,

    Лондон

    .[2]

    (

    1997

    )

    Акне: обзор результатов клинических исследований

    .

    Дерматол. клин.

    15

    ,

    97

    109

    .[3]

    (

    1989

    )

    Устойчивые к эритромицину пропионибактерии у пациентов с акне, получавших лечение антибиотиками: связь с терапевтической неудачей

    .

    руб. Дж. Дерматол.

    121

    ,

    51

    57

    .[4]

    (

    1998

    )

    Propionibacterium acnes колонизация акне и неакне

    .

    Дерматология

    196

    ,

    55

    58

    .[5]

    (

    1999

    )

    Иммунология Propionibacterium acnes и акне

    .

    Курс. мнение Заразить. Дис.

    12

    ,

    191

    197

    . [6]

    (

    1998

    )

    Иммуногистохимическое исследование формирующегося воспаления в очагах вульгарных угрей

    .

    Экспл. Дерматол.

    7

    ,

    191

    197

    .[7]

    (

    1988

    )

    Белки теплового шока

    .

    Энн.

    22

    ,

    631

    677

    .[8]

    (

    1991

    )

    Белки теплового шока как антигены бактериальных и паразитарных инфекций

    .

    Курс. Вверх. микробиол. Иммун.

    167

    ,

    145

    160

    .[9]

    (

    1992

    )

    Белки теплового шока: иммунитет и аутоиммунитет

    .

    Курс. мнение Иммунол.

    4

    ,

    396

    400

    .[10]

    (

    1989

    )

    Молекулярное клонирование: лабораторное руководство

    , 2-е изд.

    Лаборатория Колд-Спринг-Харбор

    ,

    Колд-Спринг-Харбор, Нью-Йорк

    .[11]

    (

    1997

    )

    Propionibacterium acnes , обитающий в богатой липидами коже человека, продуцирует внеклеточную липазу с молекулярной массой 33 кДа, кодируемую геном gehA

    .

    Микробиология

    143

    ,

    1745

    1755

    .[12]

    (

    1996

    )

    Регулирование и организация оперонов groE и dnaK у Eubacteria

    .

    FEMS микробиол.лат.

    138

    ,

    1

    10

    .[13]

    (

    1997

    )

    Регуляция оперона ДНК Streptomyces coelicolor A3 регулируется HspR, ауторегуляторным репрессорным белком

    .

    J. Бактериол.

    179

    (

    2

    ),

    5999

    6004

    .[14]

    (

    1999

    )

    АТФаза ClpB штамма Streptomyces albus G относится к регулону теплового шока HspR

    .

    мол. микробиол.

    31

    ,

    521

    532

    .[15]

    (

    1993

    )

    Сильно консервативный карбоксильно-концевой глицин-метиониновый мотив Escherichia coli GroEL шаперонина необязателен

    .

    мол. микробиол.

    7

    ,

    49

    58

    . [16]

    (

    1990

    )

    α-регуляторная субъединица митохондриального комплекса F1-ATPase представляет собой белок теплового шока: идентификация двух высококонсервативных аминокислотных последовательностей среди α-субъединиц и молекулярных шаперонов

    .

    Дж. Биол. хим.

    265

    ,

    7713

    7716

    .[17]

    .

    мол. микробиол.

    6

    ,

    1995

    2007

    .[18]

    (

    1994

    )

    Характеристика двух генов groEL в Streptomyces coelicolor A3

    .

    Гена

    144

    (

    2

    ),

    97

    101

    .

    © 2000 Федерация европейских микробиологических обществ

    Регулон Zur Corynebacterium glutamicum ATCC 13032 | BMC Genomics

  • 1.

    Hermann T: Промышленное производство аминокислот коринеформными бактериями. Дж Биотехнолог. 2003, 104: 155-172. 10.1016/С0168-1656(03)00149-4.

    КАС пабмед Статья Google Scholar

  • 2.

    Leuchtenberger W, Huthmacher K, Drauz K: Биотехнологическое производство аминокислот и производных: текущее состояние и перспективы. Приложение Microbiol Biotechnol. 2005, 69: 1-8. 10.1007/с00253-005-0155-у.

    КАС пабмед Статья Google Scholar

  • 3.

    Kalinowski J, Bathe B, Bartels D, Bischoff N, Bott M, Burkovski A, Dusch N, Eggeling L, Eikmanns BJ, Gaigalat L: Полная последовательность генома Corynebacterium glutamicum ATCC 13032 и ее влияние на производство аминокислот и витаминов, полученных из L-аспартата.Дж Биотехнолог. 2003, 104: 5-25. 10.1016/С0168-1656(03)00154-8.

    КАС пабмед Статья Google Scholar

  • 4.

    Brune I, Brinkrolf K, Kalinowski J, Pühler a, Tauch A: Индивидуальный и общий репертуар ДНК-связывания транскрипционных регуляторов Corynebacterium Glutamicum , Corynebacterium Efficiens , Corynebacterium Diphtheriae и Corynebacterium jeikeium , выведенный из полных последовательностей генома. Геномика BMC. 2005, 6: 86-10.1186/1471-2164-6-86.

    Центральный пабмед пабмед Статья Google Scholar

  • 5.

    Brinkrolf K, Brune I, Tauch A: Регуляторная сеть транскрипции продуцента аминокислот Corynebacterium glutamicum . Дж Биотехнолог. 2007, 129: 191-211. 10.1016/j.jbiotec.2006.12.013.

    КАС пабмед Статья Google Scholar

  • 6.

    Родионов Д.А.: Сравнительная геномная реконструкция регуляторных сетей транскрипции у бактерий. Chem Rev. 2007, 107: 3467-3497. 10.1021/cr068309+.

    КАС ПабМед Центральный пабмед Статья Google Scholar

  • 7.

    O’Halloran TV: Переходные металлы в контроле экспрессии генов. Наука. 1993, 261: 715-725. 10.1126/научн.8342038.

    ПабМед Статья Google Scholar

  • 8.

    Орам Д.М., Авдалович А. , Холмс Р.К.: Анализ генов, кодирующих DtxR-подобные регуляторы транскрипции у патогенных и сапрофитных видов коринебактерий. Заразить иммун. 2004, 72: 1885-1895. 10.1128/ИАИ.72.4.1885-1895.2004.

    КАС ПабМед Центральный пабмед Статья Google Scholar

  • 9.

    Браун Н.Л., Стоянов Дж.В., Кидд С.П., Хобман Дж.Л. Семейство регуляторов транскрипции MerR. FEMS Microbiol Rev. 2003, 27: 145-163.10.1016/S0168-6445(03)00051-2.

    КАС пабмед Статья Google Scholar

  • 10.

    Busenlehner LS, Pennella MA, Giedroc DP: Семейство металлорегуляторных репрессоров транскрипции SmtB/ArsR: структурное понимание устойчивости прокариот к металлам. FEMS Microbiol Rev. 2003, 27: 131-143. 10.1016/S0168-6445(03)00054-8.

    КАС пабмед Статья Google Scholar

  • 11.

    Эсколар Л., Перес-Мартин Дж., де Лоренцо В. : Открытие железного ящика: металлорегуляция транскрипции белком Fur. J Бактериол. 1999, 181: 6223-6229.

    КАС ПабМед Центральный пабмед Google Scholar

  • 12.

    Hantke K: Регуляция транспорта трехвалентного железа в Escherichia coli K12: выделение конститутивного мутанта. Мол Ген Жене. 1981, 182: 288-292. 10.1007/BF00269672.

    КАС пабмед Статья Google Scholar

  • 13.

    Хантке К. Регуляция содержания железа и металлов в бактериях. Curr Opin Microbiol. 2001, 4: 172-177. 10.1016/С1369-5274(00)00184-3.

    КАС пабмед Статья Google Scholar

  • 14.

    Lee JW, Helmann JD: Функциональная специализация в семействе металлорегуляторов Fur. Биометаллы. 2007, 20: 485-499. 10.1007/s10534-006-9070-7.

    КАС пабмед Статья Google Scholar

  • 15.

    Бленкоу Д.К., Морби А.П.: Метаболизм Zn(II) у прокариот. FEMS Microbiol Rev. 2003, 27: 291-311. 10.1016/S0168-6445(03)00041-Х.

    КАС пабмед Статья Google Scholar

  • 16.

    Patzer SI, Hantke K: Высокоаффинная система поглощения цинка ZnuABC и его регулятор Zur в Escherichia coli . Мол микробиол. 1998, 28: 1199-1210. 10.1046/j.1365-2958.1998.00883.x.

    КАС пабмед Статья Google Scholar

  • 17.

    Kohl TA, Baumbach J, Jungwirth B, Puhler A, Tauch A: Регулон GlxR продуцента аминокислот Corynebacterium glutamicum : in silico и in vitro обнаружение сайтов связывания ДНК глобального регулятора транскрипции. Дж Биотехнолог. 2008, 135: 340-350. 10.1016/j.jbiotec.2008.05.011.

    КАС пабмед Статья Google Scholar

  • 18.

    Brune I, Werner H, Hüser AT, Kalinowski J, Pühler A, Tauch A: Белок DtxR, действующий как двойной регулятор транскрипции, направляет глобальную регуляторную сеть, участвующую в метаболизме железа Corynebacterium glutamicum .Геномика BMC. 2006, 7: 21-10.1186/1471-2164-7-21.

    Центральный пабмед пабмед Статья Google Scholar

  • 19.

    Tauch A, Schneider J, Szczepanowski R, Tilker A, Viehoever P, Gartemann KH, Arnold W, Blom J, Brinkrolf K, Brune I: Сверхбыстрое пиросеквенирование Corynebacterium kroppenstedtii DSM44385 выявило понимание физиологии липофильная коринебактерия, в которой отсутствуют миколовые кислоты. Дж Биотехнолог. 2008, 136: 22-30.10.1016/j.jbiotec.2008.03.004.

    КАС пабмед Статья Google Scholar

  • 20.

    Gough J, Karplus K, Hughey R, Chothia C: Присвоение гомологии последовательностям генома с использованием библиотеки скрытых марковских моделей, которые представляют все белки известной структуры. Дж Мол Биол. 2001, 313: 903-919. 10.1006/jmbi.2001.5080.

    КАС пабмед Статья Google Scholar

  • 21.

    Марчлер-Бауэр А., Андерсон Дж. Б., Дербишир М. К., ДеВиз-Скотт С., Гонсалес Н. Р., Гвадз М., Хао Л., Хе С., Гурвиц Д. И., Джексон Д. Д.: CDD: консервативная база данных доменов для интерактивного анализа семейств доменов. Нуклеиновые Кислоты Res. 2007, 35: Д237-240. 10.1093/нар/гкл951.

    КАС ПабМед Центральный пабмед Статья Google Scholar

  • 22.

    Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ: Gapped BLAST и PSI-BLAST: новое поколение программ поиска белковых баз данных.Нуклеиновые Кислоты Res. 1997, 25: 3389-3402. 10.1093/нар/25.17.3389.

    КАС ПабМед Центральный пабмед Статья Google Scholar

  • 23.

    Lucarelli D, Russo S, Garman E, Milano A, Meyer-Klaucke W, Pohl E: Кристаллическая структура и функция регулятора поглощения цинка FurB из Mycobacterium tuberculosis . Дж. Биол. Хим. 2007, 282: 9914-9922. 10.1074/jbc.M609974200.

    КАС пабмед Статья Google Scholar

  • 24.

    Оцука Ю., Кавамура Ю., Кояма Т., Иихара Х., Окусу К., Эзаки Т.: Corynebacterium резистентны sp. nov., новая коринеформная бактерия с множественной лекарственной устойчивостью, выделенная из инфекций человека. Дж. Клин Микробиол. 2005, 43: 3713-3717. 10.1128/JCM.43.8.3713-3717.2005.

    Центральный пабмед пабмед Статья Google Scholar

  • 25.

    Паскуаль С., Лоусон П.А., Фэрроу Дж.А., Хименес М.Н., Коллинз М.Д.: Филогенетический анализ рода Corynebacterium на основе последовательностей генов 16S рРНК.Int J Syst Bacteriol. 1995, 45: 724-728.

    КАС пабмед Статья Google Scholar

  • 26.

    Canneva F, Branzoni M, Riccardi G, Provvedi R, Milano A: Rv2358 и FurB: два регулятора транскрипции из Mycobacterium tuberculosis , которые реагируют на цинк. J Бактериол. 2005, 187: 5837-5840. 10.1128/JB.187.16.5837-5840.2005.

    КАС ПабМед Центральный пабмед Статья Google Scholar

  • 27.

    Прайс М.Н., Хуанг К.Х., Алм Э.Дж., Аркин А.П.: Новый метод точного прогнозирования оперонов у всех секвенированных прокариот. Нуклеиновые Кислоты Res. 2005, 33: 880-892. 10.1093/нар/гки232.

    КАС ПабМед Центральный пабмед Статья Google Scholar

  • 28.

    Knoppova M, Phensaijai M, Vesely M, Zemanova M, Nesvera J, Patek M: Плазмидные векторы для тестирования промоторной активности in vivo в Corynebacterium glutamicum и Rhodococcus erythropolis 91.Карр микробиол. 2007, 55: 234-239. 10.1007/s00284-007-0106-1.

    КАС пабмед Статья Google Scholar

  • 29.

    Патек М., Несвера Дж., Гийонварч А., Рейес О., Леблон Г.: Промоторы Corynebacterium glutamicum . Дж Биотехнолог. 2003, 104: 311-323. 10.1016/S0168-1656(03)00155-Х.

    ПабМед Статья Google Scholar

  • 30.

    Росс В., Эрнст А., Гурс Р.Л.: Тонкая структура E.coli Взаимодействие РНК-полимеразы с промотором: связывание альфа-субъединицы с малой бороздкой элемента UP. Гены Дев. 2001, 15: 491-506. 10.1101/гад.870001.

    КАС ПабМед Центральный пабмед Статья Google Scholar

  • 31.

    Maciag A, Dainese E, Rodriguez GM, Milano A, Provvedi R, Pasca MR, Smith I, Palu G, Riccardi G, Manganelli R: Глобальный анализ регулона Mycobacterium tuberculosis Zur (FurB). J Бактериол.2007, 189: 730-740. 10.1128/JB.01190-06.

    КАС ПабМед Центральный пабмед Статья Google Scholar

  • 32.

    Оуэн Г.А., Паско Б., Каллифидас Д., Пэджет М.С.: Цинк-зависимая регуляция генов альтернативных рибосомных белков в Streptomyces coelicolor включает zur и sigmaR . J Бактериол. 2007, 189: 4078-4086. 10.1128/JB.01901-06.

    КАС ПабМед Центральный пабмед Статья Google Scholar

  • 33.

    Shin JH, Oh SY, Kim SJ, Roe JH: Чувствительный к цинку регулятор Zur контролирует систему поглощения цинка и некоторые рибосомные белки в Streptomyces coelicolor A3(2). J Бактериол. 2007, 189: 4070-4077. 10.1128/JB.01851-06.

    КАС ПабМед Центральный пабмед Статья Google Scholar

  • 34.

    Татусов Р.Л., Натале Д.А., Гаркавцев И.В., Татусова Т.А., Шанкаварам У.Т., Рао Б.С., Кирютин Б., Гальперин М.Ю., Федорова Н.Д., Кунин Е.В.: База данных COG: новые разработки в филогенетической классификации белков из полных геномов .Нуклеиновые Кислоты Res. 2001, 29: 22-28. 10.1093/нар/29.1.22.

    КАС ПабМед Центральный пабмед Статья Google Scholar

  • 35.

    Габриэль С.Е., Мияги Ф., Габалла А., Хельманн Д.Д.: Регуляция гена Bacillus subtilis yciC и понимание ДНК-связывающей специфичности металлорегулятора, чувствительного к цинку Zur. J Бактериол. 2008, 190: 3482-3488. 10.1128/JB.01978-07.

    КАС ПабМед Центральный пабмед Статья Google Scholar

  • 36.

    Smith KF, Bibb LA, Schmitt MP, Oram DM: Регуляция и активность регулятора поглощения цинка, Zur, в Corynebacterium diphtheriae . J Бактериол. 2009, 191: 1595-1603. 10.1128/JB.01392-08.

    КАС ПабМед Центральный пабмед Статья Google Scholar

  • 37.

    Arndt A, Eikmanns BJ: Ген алкогольдегидрогеназы adhA в Corynebacterium glutamicum подвергается углеродной катаболитной репрессии.J Бактериол. 2007, 189: 7408-7416. 10.1128/JB.00791-07.

    КАС ПабМед Центральный пабмед Статья Google Scholar

  • 38.

    Арндт А., Охтер М., Ишиге Т., Вендиш В.Ф., Эйкманнс Б.Дж.: Катаболизм этанола в Corynebacterium glutamicum . J Mol Microbiol Biotechnol. 2008, 15: 222-233. 10.1159/000107370.

    КАС пабмед Статья Google Scholar

  • 39.

    Madan Babu M, Teichmann SA: Функциональные детерминанты факторов транскрипции в Escherichia coli : семейства белков и сайты связывания. Тенденции Жене. 2003, 19: 75-79. 10.1016/S0168-9525(02)00039-2.

    КАС пабмед Статья Google Scholar

  • 40.

    Jochmann N, Kurze AK, Czaja LF, Brinkrolf K, Brune I, Huser AT, Hansmeier N, Puhler A, Borovok I, Tauch A: Генетический состав регулона Corynebacterium glutamicum LexA, выведенный из сравнительной транскриптомики и анализов сдвига полос ДНК in vitro .Микробиология. 2009, 155: 1459-1477. 10,1099/мик.0,025841-0.

    КАС пабмед Статья Google Scholar

  • 41.

    Gaballa A, Helmann JD: Идентификация специфичного для цинка металлорегуляторного белка Zur, контролирующего опероны транспорта цинка в Bacillus subtilis . J Бактериол. 1998, 180: 5815-5821.

    КАС ПабМед Центральный пабмед Google Scholar

  • 42.

    Панина Е.М., Миронов А.А., Гельфанд М.С.: Сравнительный анализ регулонов FUR у гамма-протеобактерий. Нуклеиновые Кислоты Res. 2001, 29: 5195-5206. 10.1093/нар/29.24.5195.

    КАС ПабМед Центральный пабмед Статья Google Scholar

  • 43.

    Панина Е.М., Миронов А.А., Гельфанд М.С.: Сравнительная геномика бактериальных регулонов цинка: усиленный ионный транспорт, патогенез и перестройка рибосомных белков. Proc Natl Acad Sci USA.2003, 100: 9912-9917. 10.1073/пнас.17336

    .

    КАС ПабМед Центральный пабмед Статья Google Scholar

  • 44.

    Родионов Д.А., Дубчак И., Аркин А., Алм Э., Гельфанд М.С. Реконструкция регуляторных и метаболических путей у металлредуцирующих дельта-протеобактерий. Геном биол. 2004, 5: R90-10.1186/gb-2004-5-11-r90.

    Центральный пабмед пабмед Статья Google Scholar

  • 45.

    Сантос С.Л., Виейра Дж., Таварес Ф., Бенсон Д.Р., Тиса Л.С., Берри А.М., Морадас-Феррейра П., Норманд П.: О природе эволюции меха: филогенетический подход к актинобактериям . БМС Эвол Биол. 2008, 8: 185-10.1186/1471-2148-8-185.

    Центральный пабмед пабмед Статья Google Scholar

  • 46.

    Родионов Д.А., Гельфанд М.С., Тодд Дж.Д., Керсон А.Р., Джонстон А.В.: Вычислительная реконструкция реагирующих на железо и марганец транскрипционных сетей у альфа-протеобактерий.PLoS Comput Biol. 2006, 2: e163-10.1371/journal.pcbi.0020163.

    Центральный пабмед пабмед Статья Google Scholar

  • 47.

    Riccardi G, Milano A, Pasca MR, Nies DH: Геномный анализ гомеостаза цинка в Mycobacterium tuberculosis . FEMS Microbiol Lett. 2008, 287: 1-7. 10.1111/j.1574-6968.2008.01320.х.

    КАС пабмед Статья Google Scholar

  • 48.

    Baumbach J, Brinkrolf K, Czaja LF, Rahmann S, Tauch A: CoryneRegNet: основанное на онтологии хранилище данных факторов транскрипции коринебактерий и регуляторных сетей. Геномика BMC. 2006, 7: 24-10.1186/1471-2164-7-24.

    Центральный пабмед пабмед Статья Google Scholar

  • 49.

    Baumbach J, Wittkop T, Kleindt CK, Tauch A: Комплексный анализ и реконструкция микробных сетей регуляции транскрипционных генов с использованием CoryneRegNet.Нат Проток. 2009, 4: 992-1005. 10.1038/нпрот.2009.81.

    ПабМед Статья Google Scholar

  • 50.

    Brown ED: Консервативные ГТФазы P-петли с неизвестной функцией у бактерий: новый и жизненно важный ансамбль в бактериальной физиологии. Биохим Клеточная Биол. 2005, 83: 738-746. 10.1139/о05-162.

    КАС пабмед Статья Google Scholar

  • 51.

    Гаспер Р., Скрима А., Виттингхофер А.: Структурное понимание HypB, GTP-связывающего белка, который регулирует связывание металлов.Дж. Биол. Хим. 2006, 281: 27492-27502. 10.1074/jbc.M600809200.

    КАС пабмед Статья Google Scholar

  • 52.

    Zambelli B, Turano P, Musiani F, Neyroz P, Ciurli S: Zn2+-связанная димеризация UreG из Helicobacter pylori , шаперона, участвующего в транспортировке никеля и активации уреазы. Белки. 2009, 74: 222-239. 10.1002/прот.22205.

    КАС пабмед Статья Google Scholar

  • 53.

    Хаас К.Э., Родионов Д.А., Кропат Дж., Маласарн Д., Мерчант С.С., де Креси-Лагард В.: Подмножество разнообразного семейства предполагаемых металлических шаперонов COG0523 связано с гомеостазом цинка во всех царствах жизни. Геномика BMC. 2009, 10: 470-10.1186/1471-2164-10-470.

    Центральный пабмед пабмед Статья Google Scholar

  • 54.

    Feng Y, Li M, Zhang H, Zheng B, Han H, Wang C, Yan J, Tang J, Gao GF: Функциональное определение и глобальная регуляция Zur, регулятора поглощения цинка в Streptococcus suis Штамм серотипа 2 вызывает синдром стрептококкового токсического шока.J Бактериол. 2008, 190: 7567-7578. 10.1128/JB.01532-07.

    КАС ПабМед Центральный пабмед Статья Google Scholar

  • 55.

    Huang DL, Tang DJ, Liao Q, Li HC, Chen Q, He YQ, Feng JX, Jiang BL, Lu GT, Chen B, Tang JL: Zur Xanthomonas campestris действует как репрессор и активатор предполагаемых генов гомеостаза цинка посредством распознавания двух различных последовательностей в пределах его промоторов-мишеней. Нуклеиновые Кислоты Res.2008, 36: 4295-4309. 10.1093/нар/гкн328.

    КАС ПабМед Центральный пабмед Статья Google Scholar

  • 56.

    Li Y, Qiu Y, Gao H, Guo Z, Han Y, Song Y, Du Z, Wang X, Zhou D, Yang R: Характеристика Zur-зависимых генов и прямых мишеней Zur у Yersinia pestis . БМС микробиол. 2009, 9: 128-10.1186/1471-2180-9-128.

    КАС ПабМед Центральный пабмед Статья Google Scholar

  • 57.

    Sambrook J, Fritsch EF, Maniatis T: Молекулярное клонирование: лабораторное руководство. 1989, 2

    Google Scholar

  • 58.

    Keilhauer C, Eggeling L, Sahm H: Синтез изолейцина в Corynebacterium glutamicum : молекулярный анализ оперона ilvB-ilvN-ilvC . J Бактериол. 1993, 175: 5595-5603.

    КАС ПабМед Центральный пабмед Google Scholar

  • 59.

    Tauch A, Kassing F, Kalinowski J, Pühler A: составной транспозон Corynebacterium xerosis Tn 5432 состоит из двух идентичных вставочных последовательностей, обозначенных IS 1249 , фланкирующих ген устойчивости к эритромицину 1113CX. Плазмида. 1995, 34: 119-131. 10.1006/пласт.1995.9995.

    КАС пабмед Статья Google Scholar

  • 60.

    Tauch A, Kirchner O, Wehmeier L, Kalinowski J, Pühler A: Corynebacterium glutamicum ДНК подвергается рестрикции метилирования в Escherichia coli .FEMS Microbiol Lett. 1994, 123: 343-347. 10.1111/j.1574-6968.1994.tb07246.x.

    КАС пабмед Статья Google Scholar

  • 61.

    Tauch A, Kirchner O, Löffler B, Götker S, Pühler A, Kalinowski J: Эффективная электротрансформация Corynebacterium diphtheriae с помощью мини-репликона, полученного из Corynebacterium glutamicum плазмиды pGA1. Карр микробиол. 2002, 45: 362-367. 10.1007/s00284-002-3728-3.

    КАС пабмед Статья Google Scholar

  • 62.

    Horton RM, Hunt HD, Ho SN, Pullen JK, Pease LR: Генерация гибридных генов без использования рестрикционных ферментов: сплайсинг генов путем перекрывания. Ген. 1989, 77: 61-68. 10.1016/0378-1119(89)-4.

    КАС пабмед Статья Google Scholar

  • 63.

    Schäfer A, Tauch A, Jäger W, Kalinowski J, Thierbach G, Pühler A: Небольшие мобилизуемые многоцелевые клонирующие векторы, полученные из Escherichia coli плазмид pK18 и pK19: отбор определенных делеций в хромосоме из Corynebacterium glutamicum .Ген. 1994, 145: 69-73. 10.1016/0378-1119(94)-7.

    ПабМед Статья Google Scholar

  • 64.

    Brune I, Jochmann N, Brinkrolf K, Hüser AT, Gerstmeir R, Eikmanns BJ, Kalinowski J, Pühler A, Tauch A: Репрессор транскрипции IclR-типа LtbR регулирует экспрессию генов биосинтеза лейцина и триптофана в продуцент аминокислот Corynebacterium glutamicum . J Бактериол. 2007, 189: 2720-2733. 10.1128/JB.01876-06.

    КАС ПабМед Центральный пабмед Статья Google Scholar

  • 65.

    Дондруп М., Хузер А.Т., Мертенс Д., Гесманн А.: Система оценки статистических тестов на данных микрочипов. Дж Биотехнолог. 2009, 140: 18-26. 10.1016/j.jbiotec.2009.01.009.

    КАС пабмед Статья Google Scholar

  • 66.

    Баумбах Дж., Апельцин Л.: Связь Cytoscape и справочной базы данных коринебактерий CoryneRegNet.Геномика BMC. 2008, 9: 184-10.1186/1471-2164-9-184.

    Центральный пабмед пабмед Статья Google Scholar

  • 67.

    Бенсон Д.А., Карш-Мизрачи И., Липман Д.Дж., Остелл Дж., Сэйерс Э.В.: GenBank. Нуклеиновые Кислоты Res. 2009, 37: Д26-31. 10.1093/нар/гкн723.

    КАС ПабМед Центральный пабмед Статья Google Scholar

  • 68.

    Миронов А.А., Винокурова Н.П., Гельфанд М.С.: [Программное обеспечение для анализа бактериальных геномов].Мол Биол (Моск). 2000, 34: 253-262.

    КАС Статья Google Scholar

  • 69.

    Миронов А.А., Кунин Е.В., Ройтберг М.А., Гельфанд М.С.: Компьютерный анализ паттернов регуляции транскрипции в полностью секвенированных бактериальных геномах. Нуклеиновые Кислоты Res. 1999, 27: 2981-2989. 10.1093/нар/27.14.2981.

    КАС ПабМед Центральный пабмед Статья Google Scholar

  • 70.

    Crooks GE, Hon G, Chandonia JM, Brenner SE: WebLogo: генератор последовательностей логотипов. Геном Res. 2004, 14: 1188-1190. 10.1101/гр.849004.

    КАС ПабМед Центральный пабмед Статья Google Scholar

  • 71.

    Фельзенштейн Дж. Метод чередующихся наименьших квадратов для вывода филогении из попарных расстояний. Сист биол. 1997, 46: 101-111.

    КАС пабмед Статья Google Scholar

  • 72.

    Ларкин М.А., Блэкшилдс Г., Браун Н.П., Ченна Р., МакГеттиган П.А., Маквильям Х., Валентин Ф., Уоллес И.М., Уилм А., Лопес Р.: Clustal W и Clustal X, версия 2.0. Биоинформатика. 2007, 23: 2947-2948. 10.1093/биоинформатика/btm404.

    КАС пабмед Статья Google Scholar

  • 73.

    Грант С.Г., Джесси Дж., Блум Ф.Р., Ханахан Д.: Дифференциальное спасение плазмид из ДНК трансгенных мышей в мутантов Escherichia coli , ограничивающих метилирование.Proc Natl Acad Sci USA. 1990, 87: 4645-4649. 10.1073/пнас.87.12.4645.

    КАС ПабМед Центральный пабмед Статья Google Scholar

  • 74.

    Schäfer A, Schwarzer A, Kalinowski J, Pühler A: Клонирование и характеристика области ДНК, кодирующей чувствительную к стрессу рестрикционную систему из Corynebacterium glutamicum ATCC 13032 и анализ ее роли в межродовой конъюгации с Escherichia палочка .J Бактериол. 1994, 176: 7309-7319.

    Центральный пабмед пабмед Google Scholar

  • 75.

    Kirchner O, Tauch A: Инструменты для генной инженерии в продуцирующей аминокислоты бактерии Corynebacterium glutamicum . Дж Биотехнолог. 2003, 104: 287-299. 10.1016/С0168-1656(03)00148-2.

    КАС пабмед Статья Google Scholar

  • Границы | Чувство кворума: малоизученный феномен в типе Actinobacteria

    Введение

    Межклеточная коммуникация у бактерий через определение кворума представляет собой зависящую от плотности регуляцию экспрессии генов.Система основана на двух основных компонентах: сигнальной молекуле и белке-активаторе транскрипции. Во многих грамотрицательных бактериях член семейства N-ацилгомосеринлактона (АГЛ) действует как диффундирующая сигнальная молекула, синтез которой контролируется членами семейства синтаз LuxI (рис. 1). При превышении пороговой концентрации эта сигнальная молекула активирует гены-мишени совместно с членом семейства транскрипционных активаторов LuxR (Fuqua et al., 1996).Основанная на AHL система восприятия кворума играет важную роль в регуляции множества функций, таких как биолюминесценция (Nealson and Hastings, 1979), синтез антибиотиков (Bainton et al., 1992), производство факторов вирулентности (Barber et al., 1997). , биосинтез экзополисахарида (Beck von Bodman and Farrand, 1995), скопление бактерий (Eberl et al., 1996) и конъюгальный перенос плазмид (Fuqua and Winans, 1994). Напротив, большинство грамположительных бактерий используют процессированные олигопептиды для передачи сигналов и коммуникации (Kleerebezem et al., 1997; Стурме и др., 2002). Эти сигналы, называемые аутоиндуцирующими полипептидами (AIP), продуцируются в цитоплазме в виде пептидов-предшественников и впоследствии расщепляются, модифицируются и экспортируются. Известно, что системы определения кворума на основе AIP регулируют экспрессию многих факторов, таких как генетическая компетентность (Solomon et al., 1995), спорообразование (Magnuson et al., 1994) и экспрессия факторов вирулентности (Qin et al., 2000). Хотя может показаться, что дифференциация типа сигнального соединения является следствием структурных различий в клеточной стенке между двумя типами бактерий; Тем не менее, это не так.Например, известно, что некоторые актинобактерии (грамположительные) используют γ-бутиролактоны для передачи сигналов, тогда как известно, что большинство грамотрицательных бактерий обладают сигнальными пептидами как частью своего генома (Lyon and Novick, 2004). Независимо от типа клеток, ощущение кворума является почти универсальным способом межклеточной коммуникации среди патогенных бактерий. Следовательно, в настоящее время он считается важной мишенью для контроля их распространения, особенно устойчивых к антибиотикам бактерий.

    РИСУНОК 1. Схемы систем определения кворума у ​​бактерий. (A) Грамотрицательные бактерии: при пороговых концентрациях диффундирующая сигнальная молекула аутоиндуктора, обычно лактон гомосерина, связывается со своим родственным рецептором внутри клетки, образуя комплекс аутоиндуктор-рецептор, который затем регулирует экспрессию генов-мишеней посредством связывания с целевой промотор; и (B) Грамположительные бактерии: при пороговых концентрациях молекула аутоиндукторного пептида, которая активно транспортируется, активирует белок сенсорной киназы внутри клетки, который фосфорилирует белок регулятора ответа, который затем регулирует экспрессию генов-мишеней посредством его связывания с целевой промоутер.Адаптировано из Koh et al. (2013).

    Несмотря на разнообразие и важность фенотипов, которые регулируются сетью распознавания кворума, информация об их распространении в окружающей среде очень ограничена. Кроме того, те, которые доступны, сосредоточены только на AHL-опосредованных системах экспрессии генов. Исследование, проведенное Manefield and Turner (2002), показало, что только 2,2% (21 род бактерий) от общего числа родов бактерий, перечисленных в «Руководстве Берджи по систематической бактериологии» (Garrity et al., 2001) содержат виды, продуцирующие AHL, и все они относятся только к альфа-, бета- и гамма-протеобактериям. На уровне вида процент продуцентов АГЛ падает до долей процента. Хотя этой оценке более десяти лет, она по-прежнему отражает состояние информации, доступной в отношении определения кворума у ​​бактерий. Мотивированный отсутствием информации, наш скрининг гомологов luxRI и продукции АГЛ в роде Aeromonas не только показал, что гомологи повсеместно присутствуют в этом роде, но также сообщил, что виды секретируют большое разнообразие АГЛ. в роду (Jangid et al., 2007, 2012). Это исследование лишь указывает на тот факт, что ощущение кворума действительно является широко распространенным явлением среди бактерий, однако систематических доказательств не хватает. Таким образом, существует необходимость исследовать существование и изучить таксономическое распределение систем распознавания кворума среди бактериальных таксонов.

    Тип Actinobacteria является одним из крупнейших типов в домене Bacteria и состоит из шести классов, 23 отрядов, включая один Incerta sedis и 53 семейства (Ludwig et al., 2012). По состоянию на декабрь 2015 г. в этом типе насчитывалось 342 рода со статусом в номенклатуре, определенной из базы данных LPSN (Parte, 2015). Актинобактерии, как правило, грамположительны, но иногда окрашиваются вариабельно и имеют жесткую клеточную стенку, которая содержит мурамовую кислоту, а некоторые стенки содержат тейхоевые кислоты. Этот тип включает множество фенотипически разнообразных организмов, широко распространенных в природе и предъявляющих различные требования к кислороду, питанию, температуре и pH для роста, что делает его важным типом.

    Благодаря своему разнообразному физиологическому потенциалу актинобактерии играют доминирующую роль в биотехнологической промышленности. Их применение широко распространено и варьируется от агропромышленности, фармацевтики, биоремедиации и многих других. Они играют ключевую роль в естественных геохимических циклах, особенно благодаря своей способности разлагать органическое вещество. Актинобактерии также многочисленны в ризосфере и продуцируют широкий спектр биологически активных метаболитов, тем самым влияя на развитие растений (Selvakumar et al., 2014). Многие актинобактерии также являются известными патогенами растений и животных. Тем не менее, среди наиболее важных потенциальных возможностей актинобактерий наиболее широко используется производство значительного количества вторичных метаболитов, таких как антибиотики и другие соединения, представляющие биотехнологический интерес. Например, среди полиеновых макролидов класс поликетидов, являющихся противогрибковыми соединениями, синтезируется более чем 100 различными видами актиномицетов (Recio et al., 2004). Кроме того, известно, что представители рода Streptomyces производят более 70% коммерчески доступных антибиотиков (Weber et al., 2003). Экспрессия детерминант вирулентности, продукция вторичных метаболитов и морфогенез связаны с высокой плотностью клеток и, как правило, контролируются диффундирующими низкомолекулярными химическими веществами, подобными грамотрицательным аутоиндукторам, что указывает на роль чувства кворума в регуляции этих механизмов (Takano , 2006; Сантос и др., 2012). Дальнейшее изучение новых фенотипов в соответствии с правилами определения кворума, вероятно, будет способствовать прогрессу в области медицины, биотехнологии и экологии.Следовательно, существует необходимость изучения чувства кворума у ​​ Actinobacteria.

    Большая часть того, что известно о чувстве кворума у ​​актинобактерий, получено в результате изучения продукции антибиотиков у этих таксонов. Хотя это действительно самое важное явление, цель этого обзора не состоит в том, чтобы представить обзор регуляции производства антибиотиков с помощью чувства кворума. Поэтому читателю предлагается прочитать Takano (2006), Liu et al. (2013) и ссылки внутри. Далее, для ясности, Actinobacteria означает все виды в пределах типа Actinobacteria , если не указано иное как класс Actinobacteria.

    В этом обзоре мы представляем обзор систем распознавания кворума, описанных до сих пор для типа Actinobacteria , указывая на ограничения существующих стратегий скрининга и обращаясь к улучшениям в новых технологиях для обнаружения ощущения кворума в большем количестве таксонов. Кроме того, мы обобщаем текущее состояние известной деятельности по подавлению кворума в этом типе.

    Чувство кворума в типе

    Actinobacteria

    Хотя Actinobacteria является одной из крупнейших групп организмов в бактериальном домене, было доступно очень мало отчетов об известной регуляции чувства кворума в этом типе.Анализ литературы по чувству кворума у ​​актинобактерий показал, что только 25 родов актинобактерий имеют какую-то регуляцию чувства кворума (рис. 2). Это число составляет всего 7,3% от 342 родов, указанных в последнем обновлении LPSN (Parte, 2015). Из них только девять родов (2,6%) имеют известную регуляцию чувства кворума, тогда как известно, что остальные 16 родов (4,7%) содержат только гомологи LuxR на основе анализа доступных последовательностей генов/геномов. Примечательно, что 24 из 25 родов принадлежали к одному классу Actinobacteria , тогда как только один род Rubrobacter принадлежал к классу Rubrobacteria. Для остальных четырех классов актинобактерий отчетов не было: Acidimicrobiia, Coriobacteriia, Nutriliruploria и Thermoleophilia . Этот краткий список на самом деле предполагает, что существуют огромные возможности для скрининга большего количества таксонов для дальнейшего изучения чувства кворума у ​​Actinobacteria.

    РИСУНОК 2. Семейное дерево типа Actinobacteria, основанное на последовательности гена 16S рРНК , изображающее роды с известными системами распознавания кворума. Эволюционная история была выведена с использованием метода Neighbor-Joining (Saitou and Nei, 1987) с использованием бутстрап-теста филогении (1000 повторов) (Felsenstein, 1985). Эволюционные расстояния рассчитывались с использованием двухпараметрического метода Кимуры (Kimura, 1980). Эволюционный анализ проводился в MEGA6 (Tamura et al., 2013). Всего для построения дерева было использовано 54 последовательности, принадлежащие типовым видам типовых родов каждого семейства, как описано в Ludwig et al. (2012) и представлены в качестве дополнительных данных в формате fasta.Ветвь черного цвета обозначает семью без признаков кворума; красный цвет обозначает семью с экспериментальными свидетельствами чувства кворума; зеленый цвет обозначает семейство, для которого известны только гомологи генов; ‘’ указывает на род, для которого известны только гомологи гена; а ‘ ∗∗ ’ обозначает род, для которого предполагаемые AHL-подобные сигнальные молекулы участвуют в восприятии кворума.

    Одной из систем определения кворума, которая, по-видимому, ограничена актинобактериями, является система γ -бутиролактона (GBL).Система ГБЛ очень похожа на систему на основе АГЛ у грамотрицательных бактерий из-за структурного сходства между ГБЛ и АГЛ, а также из-за того, что это однокомпонентная система, в которой белок, чувствительный к коммуникационной молекуле, также является регулятором ответа (Takano , 2006). Большинство сообщений о GBL-системе относится к роду Streptomyces , который продуцирует множество важных вторичных метаболитов и подвергается сложной программе морфологической дифференциации (Horinouchi and Beppu, 1993; Takano et al., 2000) (табл. 1). В большинстве случаев эти процессы находятся под прямым контролем ауторегулятора ГБЛ в тандеме со специфическими родственными рецепторами ГБЛ (Healy et al., 2009). Диффундирующий через мембрану ауторегулятор ГБЛ контролирует экспрессию структурных генов, кодирующих ферменты пути вторичного метаболита. Рецепторы GBL являются регуляторами транскрипции, принадлежащими к суперсемейству факторов транскрипции TetR (Nishida et al., 2007). Учитывая большое количество видов рода Streptomyces и очень мало известных регуляторных систем GBL, требуется гораздо больше работы над сигнальным каскадом и рецепторными белками.

    ТАБЛИЦА 1. Состояние систем определения кворума в Actinobacteria .

    За исключением хорошо охарактеризованной системы на основе ГБЛ Streptomyces sp. (Takano, 2006), коммуникация в этом типе почти не изучена. Основываясь в основном на косвенных данных, Santos et al. (2012) внесли значительный вклад в увеличение числа родов, которые, как известно, содержат гомологов LuxR. О диверсифицированной и стереоскопической организации белков LuxR среди членов этого типа сообщалось в результате обширного анализа in silico филогеномного распределения и функционального разнообразия белков LuxR.Авторы идентифицировали в общей сложности 991 белковую последовательность из 53 видов, которые содержали по крайней мере один домен LuxR. Распределение этих последовательностей не было равномерным среди видов и варьировалось от организмов с одной последовательностью (например, Mycobacterium leprae ) до других с более чем 50 (например, Streptomyces sp.). Используя стратегию, основанную на доменах, было показано, что семейство белков LuxR в Actinobacteria включает два основных подсемейства: одно, напоминающее классические регуляторы транскрипции LuxR, и другое, в котором домен LuxR связан с N-концевым доменом REC (ресивер).В третьей и меньшей группе последовательностей домен LuxR, по-видимому, связан с серией доменов, связанных с трансдукцией сигнала, отличных от REC, образуя мультидоменные белки (Santos et al., 2012). С точки зрения эволюции было показано, что последовательность предкового гена закодирована для белка с одним доменом LuxR. Исходные гены, кодирующие LuxR, затем претерпели ряд дупликаций, за которыми, предположительно, последовала функциональная спецификация, но они также приобрели разные домены, порождая новые подсемейства с последствиями в широком диапазоне функций.Описанные филогенетические результаты предполагают заметную неразборчивость домена LuxR среди актинобактерий. Для получения подробной информации о распределении белков LuxR внутри филума читателю предлагается обратиться к оригинальному исследованию (Santos et al., 2012).

    Избирательные актинобактерии с известными системами определения кворума

    Streptomyces

    Род Streptomyces с 778 видами (Parte, 2015) является крупнейшим родом Actinobacteria и является естественным обитателем почв и разлагающейся растительности. Streptomyces характеризуются сложной морфологической дифференциацией и способностью продуцировать различные вторичные метаболиты, составляющие две трети встречающихся в природе антибиотиков. Синхронизированное поведение этих видов в производстве антибиотиков и модуляции экспрессии генов регулируется ощущением кворума через спектр небольших химических сигнальных молекул, называемых ГБЛ (Bhukya et al., 2014). ГБЛ свободно диффундируют через клеточную мембрану и регулируют эти пути, когда внутри- и внеклеточная концентрация ГБЛ достигает порогового значения.В этом смысле они ведут себя очень похоже на определение кворума на основе AHL у грамотрицательных бактерий.

    Многое из того, что известно об актинобактериальном распознавании кворума, может быть связано с информацией, полученной от Streptomyces при распознавании кворума на основе ГБЛ. На самом деле, первые сигнальные молекулы, ГБЛ, уже были известны из Streptomyces в 1960-х годах (Хохлов и др., 1967), задолго до того, как термин «чувство кворума» был придуман Fuqua et al. (1994). Сегодня по крайней мере 60% из видов Streptomyces , по-видимому, продуцируют ГБЛ, регулирующие множественные фенотипы, даже в наномолярных концентрациях (Takano et al., 2000). Большинство ГБЛ структурно сходны, но химически различны. Они экстрагируются органическими растворителями и устойчивы к воздействию тепла, протеаз и кислот. Хотя они имеют структурное сходство с АГЛ (за исключением боковой углеродной цепи, рис. 3), рецепторы ГБЛ не связываются с АГЛ и наоборот. Известно, что на геномном уровне у Streptomyces существует линейно-специфический гомолог белка LuxR с очень ограниченным разнообразием ассоциированных доменов (Santos et al., 2012).

    РИСУНОК 3. Структуры репрезентативных сигнальных молекул в Actinobacteria . A-фактор Streptomyces griseus , ГБЛ S. coelicolor (SCB1, SCB2 и SCB3), ММФ S. coelicolor , которые структурно различны, имеют общий 2-алкил-4-гидроксиметилфуран- Структура ядра 3-карбоновой кислоты, но отличается идентичностью C2 алкильной группы. Для сравнения показан С4-гомосеринлактон штамма Pseudomonas aeruginosa .Адаптировано из книги Уилли и Гаскелла (2011).

    Их молекулярный механизм представляет собой разнообразную и сложную систему (Choi et al., 2003). Наиболее интенсивно изучаемым ГБЛ является А-фактор или ауторегуляторный фактор (2-изокаприлоил-3 R -гидроксиметил-г-бутиролактон), который, как известно, контролирует экспрессию более дюжины генов, среди которых продукция стрептомицина и споруляция у Streptomyces griseus изучена наиболее широко (Takano et al., 2000) (рис. 4).Известно, что он оказывает воздействие как на клональные гифы в одном мицелии, так и на генетически отличные гифы S. griseus . А-фактор, вероятно, диффундирует между филаментами и действует, связываясь с рецептором А-фактора, ArpA, который является репрессором транскрипции, нацеленным на adpA . При связывании комплекс A-фактор-ArpA активирует экспрессию adpA (Willey and Gaskell, 2011). Под действием AdpA-зависимой активации находится ряд генов, таких как strR , экспрессия которых регулирует кластер генов биосинтеза стрептомицина, и гены, участвующие в морфологической дифференцировке.Все характеристики А-фактора говорят нам, что А-фактор является микробная гормона сопоставима с эукариотических гормонов, таких как половые феромоны, контролирующих дифференциацию грибов (Horinouchi и Beppu, 1993). Тем не менее, это не является ни наиболее распространенным, ни самой стабильной ГБЛ. С. coelicolor butanolide 1 (SCB1), ранее сообщалось, чтобы стимулировать сине-пигментированные поликетидный actinorhodin (Закон) и красно-пигментированной три-pyrolle undecylprodigiosin (красный) производство в фазово-зависимым способом роста, как известно, наиболее в изобилии и более стабильный, чем а-фактор (Таканно, 2006).Были идентифицированы гены, участвующие в синтезе SCB1 ( scbA ) и связывании ( scbR ) (Gottelt et al., 2012). ScbR регулирует транскрипцию как scbA, так и самого себя, связываясь с дивергентной промоторной областью, контролирующей оба гена, а GBL SCB1 ингибирует это связывание. Известно, что S. coelicolor продуцирует несколько ГБЛ с различной биологической активностью. Точно так же S. virginiae продуцирует по меньшей мере пять бутанолидов виргинии (VB-A, B, C, D и E), которые стимулируют выработку виргиниамицина, каждый с различной минимальной эффективной концентрацией.Напротив, как S. griseus , так и S. lavendulae продуцируют один ГБЛ, А-фактор и IM-2 соответственно. В то время как А-фактор регулирует продукцию стрептомицина у S. griseus , IM-2 регулирует продукцию нуклеозидных антибиотиков шоудомицина и минимицина у S. lavendulae (Gottelt et al., 2012). Присутствие нескольких ГБЛ у Streptomyces указывает на сложные механизмы коммуникации, которые существуют в этом роде и до сих пор не изучены в деталях.

    РИСУНОК 4. S. griseus А-фактор регулон. Подобно грамотрицательным бактериям, в пороговых концентрациях диффундирующий фактор А (γ-бутиролактон) связывается с внутриклеточным рецептором ArpA и активирует экспрессию активатора транскрипции AdpA, который, в свою очередь, регулирует множественные фенотипы либо косвенно, через многоступенчатый каскад , такие как развитие воздушных гиф и спороношение, или непосредственно, такие как производство вторичных метаболитов, таких как стрептомицин.

    О новом классе водорастворимых аутоиндукторов, отличных от ГБЛ, сообщили Recio et al. (2004). Этот фактор, называемый фактором PI, был идентифицирован как 2,3-диамино-2,3-бис(гидроксиметил)-1,4-бутандиол (рис. 3). Он был выделен из S. natalensis и регулирует биосинтез пимарицина в организме. При использовании комплементарного анализа продукция пимарицина восстанавливалась в присутствии А-фактора у мутанта с нарушением пимарицина. Подобно другим ГБЛ, фактор PI также активен в наномолярных концентрациях.Однако восстановление продукции пимарицина в присутствии как фактора А, так и фактора PI предполагает, что S. natalensis имеет интеграцию множественных сигналов кворума от актиномицетов. Интересно, что о факторе PI в микробном мире не сообщалось, и он имеет совершенно новую химическую структуру, которая лишь отдаленно связана с семействами индукторов гомосеринлактона и фуранозилового диэфира. Эти уникальные свойства фактора PI только указывают на тот факт, что этот таксон обладает большим потенциалом для дальнейшего изучения чувства кворума.

    Недавно было показано, что в дополнение к ГБЛ метиленомицинфураны (ММФ) регулируют выработку антибиотиков у S. coelicolor посредством определения кворума (Willey and Gaskell, 2011). Различные мутанты S. coelicolor , у которых дефицит продукции метиленомицина, будут совместно синтезировать антибиотик при выращивании в непосредственной близости друг от друга, что позволяет предположить, что в его биосинтезе участвует диффузный сигнал. Между ними мутантный штамм, спасший непродуцента, называется «секретором», тогда как тот, который восстановил способность продуцировать антибиотик при выращивании рядом с секретором, называется «конвертером».Исследования показали, что секреторные штаммы обладают способностью синтезировать небольшие сигнальные молекулы, подобные ГБЛ, называемые ММФ, но сами по себе лишены генов биосинтеза метиленомицина, в то время как для конвертеров верно обратное. Несмотря на то, что они очень похожи на ГБЛ по химическим свойствам, ММФ отличаются структурно с общим ядром из 2-алкил-4-гидроксиметилфуран-3-карбоновой кислоты, но другой алкильной группой C2 (рис. 3). Открытие MMFs указывает лишь на тот факт, что исследование чувства кворума у ​​Actinobacteria очень ограничено, и возможность открытия таких новых гомологов не надуманная, просто необходим систематический подход (Willey and Gaskell, 2011).

    Микобактерии

    Микобактерии имеют огромное медицинское значение во всем мире. Mycobacterium tuberculosis является успешным патогеном для человека, насчитывающим ∼2 × 10 90 556 9 90 557 особей; почти одна треть населения мира инфицирована во всем мире (Banaiee et al., 2006). Отличительной чертой микобактерий является наличие более толстой клеточной стенки, богатой миколовыми кислотами, и очень низкая скорость роста. С появлением лекарственной устойчивости лечение микобактериальных инфекций становится все более трудным, и поэтому поиск новых мишеней для лекарств, особенно тех, которые связаны с определением кворума, является важным компонентом исследований микобактерий.Однако грамположительные микобактерии остаются загадкой, и нет четких доказательств их механизма восприятия кворума (Sharma et al., 2014). Биоинформатический анализ выявил присутствие гомологов LuxR в M.tuberculosis , но экспериментальные подтверждения отсутствуют (Chen and Xie, 2011; Santos et al., 2012). Некоторые из этих гомологов повсеместно распространены среди множества видов микобактерий и участвуют в формировании или сохранении микобактериальной биопленки, что указывает на возможное существование сходных механизмов восприятия кворума.Учитывая тот факт, что образование биопленок в основном связано с регуляцией чувства кворума и со многими нетуберкулезными микобактериями, которые, как известно, образуют биопленки, такие как M. smegmatis, M. marinum, M. fortuitum, M. chelonae, M. Ulcarans, M. Abscessus, M. Avium и M. BOVIS (Sharma et al., 2014), существование чувства кворума в этих организмах не может быть исключено. Однако эта гипотеза нуждается в экспериментальной проверке.

    Доказательства кворума, чувствуя в микобактериях, в основном косвенно.Ген M.tuberculosis whiB3 , предполагаемый регулятор транскрипции, который недавно был вовлечен в возникновение грубых и микроскопических поражений, скорее всего, находится под контролем чувства кворума (Banaiee et al., 2006). Хотя никаких доказательств представлено не было, было показано, что паттерн экспрессии whiB3 отражает изменения в плотности бактерий, что указывает на роль чувства кворума в его регуляции. Исследование 22 генов M.tuberculosis показало, что whiB3 индуцировались максимально на ранней стадии инфекции в легких мыши и культивируемых макрофагах.Экспрессия whiB3 обратно коррелировала с плотностью бактерий в легком мыши, среде BMMϕ и бульонной культуре (Banaiee et al., 2006). Поскольку этот паттерн экспрессии согласуется с ощущением кворума, необходимы дальнейшие исследования для изучения этой системы у M. tuberculosis .

    Еще одно косвенное свидетельство участия регуляции чувства кворума у ​​микобактерий известно благодаря исследованиям вторичных мессенджеров. Вторичные мессенджеры — это те соединения, которые участвуют в сигнальном каскаде фосфорелейной передачи, позволяя «расшифровывать» «закодированную» информацию, полученную в виде молекул, воспринимающих кворум (аутоиндукторы), чтобы ощущать и вносить соответствующие изменения в окружающую среду путем экспрессии генов-мишеней. (Бхарати и Чаттерджи, 2013 г.).Таким образом, меж- и внутриклеточная передача сигналов должна быть интегрирована. Различные небольшие молекулы, такие как моно (цАМФ и цГМФ) и дициклические или модифицированные нуклеотиды (ppGpp, ц-ди-ГМФ и ц-ди-АМФ), являются важными внутриклеточными сигнальными молекулами микобактерий и играют ключевую роль. роль в передаче сигналов, полученных от рецептора (на поверхности), к молекуле-мишени в клетке (Sharma et al., 2014). Эти вторичные мессенджеры на основе нуклеотидов регулируют различные процессы в различных бактериальных системах.Из них c-di-GMP является вездесущим бактериальным вторичным мессенджером, и известно, что в эффективных концентрациях он способствует фенотипам, таким как вирулентность и образование биопленки. Участие этих вторичных мессенджеров косвенно предполагает существование систем восприятия кворума как у патогенных, так и у непатогенных микобактерий (Sharma et al., 2014).

    Пропионибактерии

    Propionibacterium acnes представляет собой анаэробную грамположительную палочковидную бактерию, которая является естественным обитателем кожи человека.Он играет важную роль в патогенезе вульгарных угрей, распространенного заболевания сально-волосяных фолликулов. Однако по мере прогрессирования инфекции микроорганизмы проявляют устойчивость к антибиотикам. Фактически, наблюдается постепенное снижение эффективности местного применения эритромицина, скорее всего, из-за развития резистентности через образование биопленки. Действительно, геномный анализ P. acnes показывает, что организм имеет три отдельных кластера генов, которые кодируют ферменты, участвующие в биосинтезе внеклеточных полисахаридов, что позволяет предположить, что он способен формировать необходимый матрикс внеклеточной биопленки (Coenye et al., 2007). Дальнейшие эксперименты показали, что организм способен образовывать биопленки, а также продемонстрировали повышенную выработку аутоиндуктора AI-2 сидячими клетками P. acnes и усиление его вирулентной активности, такой как гидролиз триглицеридов кожного сала его бактериальными липазами. , секретирующие свободные жирные кислоты (СЖК), такие как олеиновая, пальмитиновая и лауриновая кислоты. Считается, что повышенная концентрация таких раздражающих жирных кислот способствует воспалению и, таким образом, играет важную роль в патогенезе акне.Хотя открытие AI-2 предполагает наличие у этого организма чувства кворума, механизмы его регуляции до сих пор не ясны.

    В интересной гипотезе Lwin et al. (2014) предположили, что ощущение кворума косвенно играет роль в патогенезе акне. Основываясь на модели опасности иммунитета Матцингера (1994), в которой утверждается, что ответы на антигены не зависят исключительно от распознавания «чужих» иммунной системой, инициация оптимального иммунного ответа требует ощущения повреждения ткани или доказательств. патогенного микроорганизма через так называемые «сигналы опасности».В случае акне СЖК действуют как опасные молекулярные паттерны. При контролируемом росте в качестве кожного комменсала P. acnes не посылает сигналы «безопасности» или посылает только сигналы «опасности», но посылает сигналы «опасности» через определение кворума в виде избыточного производства СЖК во время патогенного состояния, тем самым стимулируя воспаление. На сегодняшний день нет in vivo свидетельств ощущения кворума с помощью P. acnes , даже несмотря на то, что этот организм вырабатывает известный сигнал определения кворума, AI-2. Однако экспериментальное подтверждение этой гипотезы, вероятно, предложит новые терапевтические цели, а также откроет новые возможности ощущения кворума в этом организме.

    Родококк

    Актинобактерии рода Rhodococcus являются аэробными, грамположительными или вариабельными и неподвижными. Они представляют собой группу с замечательным метаболическим разнообразием, что делает их идеальными кандидатами для использования в биоремедиации загрязненных участков и в качестве биокатализаторов во время биотрансформаций. Следовательно, они представляют интерес для химической, экологической, энергетической и фармацевтической отраслей (Jones and Goodfellow, 2012). Дальнейшие исследования физиологического потенциала этой группы актинобактерий, имеющие большое экономическое значение, приобретают все большее значение.

    Наличие чувства кворума у ​​ Rhodococcus известно только благодаря биоинформационным данным, основанным на геномных последовательностях нескольких штаммов. Хотя ГБЛ был обнаружен в культуральной среде Rhodococcus rhodochrous NCIMB 13064, было показано, что ГБЛ накапливается за счет химического окисления галоалкана в культурах с высокой плотностью клеток (Curragh et al., 1994). Анализ in silico генома Rhodococcus erythropolis PR4 выявил присутствие генов, кодирующих синтазу коммуникационной молекулы, AfsA, и регулятор ответа коммуникационной молекулы, ArpA, с 31 и 36% идентичностью аминокислотной последовательности, соответственно, что предполагает возможное присутствие функциональной системы восприятия кворума на основе ГБЛ у этого штамма (Latour et al., 2013). Аналогичный анализ генома штамма Rhodococcus RHA1 показал присутствие гомологов белковых доменов как GBL-синтазы, так и рецептора, что позволяет предположить, что GBL также может играть роль в этом организме (Wuster and Babu, 2008). Тот факт, что и гены синтазы, и гены регулятора ответа находятся в непосредственной близости друг от друга, как в случае основанных на AHL систем распознавания кворума, предполагает, что эти гомологи могут действовать как система распознавания кворума. Это говорит о том, что такая система присутствует у Rhodococcus .

    Бифидобактерии

    Благодаря значительным усилиям по классификации микробиома человека новая информация показала, что представители рода Bifidobacteria представляют собой одну из доминирующих групп нормальной микробиоты желудочно-кишечного тракта человека. Они также являются одними из первых колонизаторов желудочно-кишечного тракта после рождения. На геномном уровне все общедоступные геномные последовательности бифидобактерий содержат предполагаемые генов luxS , а соответствующие им аминокислотные последовательности хорошо сохранились в этом роде с >82% сходства последовательностей с белком LuxS Vibrio harveyi (Sun et al. ., 2014). Используя эту информацию, Sun et al. (2014) экспериментально подтвердили, что Bifidobacteria sp. проявляют LuxS-зависимую активность AI-2 и образование биопленок. В этом контексте AI-2-зависимое образование биопленки, например, на частицах пищи или слизи хозяина, может быть важным механизмом ранней колонизации хозяина комменсальными штаммами или персистенции пробиотических штаммов в течение длительного времени (Sun et al. , 2014). Имея серьезные последствия для здоровья человека из-за их использования в качестве пробиотиков, преимущества использования способности бифидобактерий к образованию биопленок огромны.

    Другие актинобактерии

    Свидетельств о чувстве кворума у ​​других родов актинобактерий очень мало. Известно, что по крайней мере три близкородственных рода Streptomyces , не относящихся к , продуцируют ауторегуляторы GBL и их рецепторные белки на основании анализа специфического связывания лиганда (Choi et al., 2003). Используя анализ связывания с меченными тритием аналогами ауторегуляторов в качестве лигандов, авторы провели скрининг неочищенных бесклеточных лизатов пяти различных штаммов Streptomyces , отличных от , с периодическими отборами проб во время культивирования до 96 часов.Авторы пришли к выводу, что продуцент тейкопланина Actinoplanes teichomyceticus IFO13999 продуцирует ауторегулятор типа VB, тогда как продуцент рифамицина Amycolatopsis mediterranei IFO13415 и продуцент гентамицина Micromonospora echinospora IFO1138 Однако ауторегулятор IM-2, продуцируемый M. echinospora , вероятно, имел более длинную боковую цепь C2, поскольку биосенсорный штамм S. lavendulae FRI-5 распознает только ауторегуляторы типа IM-2, имеющие длину боковой цепи C2 4–5 атомов углерода (Choi et al., 2003). Более того, продукция ауторегуляторов примерно соответствовала поздней экспоненциальной фазе роста и достигала плато между 48 и 60 часами на ранней стационарной фазе. Неспособность обнаружить ауторегуляторы у двух других штаммов, Actinoplanes sp. ATCC 31044 и Amycolatopsis orientalis IFO12806 не исключают возможности того, что в различных условиях эти штаммы могут продуцировать ауторегулятор(ы). Следовательно, скрининг ауторегуляторов в различных условиях с использованием нескольких биосенсоров является ключом к будущему.

    Среди других актинобактерий существуют данные анализа генома для Frankia и Nocardia , что они обладают гомологами AfsA и ArpA соответственно (Wuster and Babu, 2008). Точно так же система LuxR, включающая предполагаемый двухкомпонентный регулятор системного ответа семейства белков LuxR вместе с 23 регуляторами транскрипции, как сообщается, присутствует в Nocardia brasiliensis HUJEG-1, как определено на основе его полной последовательности генома (Vera-Cabrera et др., 2013). Кроме того, известно, что представители родов Acidothermus, Arthrobacter, Brevibacterium, Clavibacter, Corynebacterium, Kineococcus, Kocuria, Nocardoides, Renibacterium, Rubrobacter, Saccharopolyspora, Salinispora и Thermobifida содержат гомологи регуляторов LuxR (Takano, 2006; Сантос и др., 2012). Хотя регуляторы LuxR также могут быть вовлечены во внутриклеточную передачу сигналов, присутствие белков LuxR интригует, поскольку известно, что AHL не действуют на актинобактериальные системы восприятия кворума, где передача сигналов обычно обеспечивается циклическими или модифицированными пептидами и GBL.Однако это не исключает возможности того, что AHL-опосредованное ощущение кворума не существует у Actinobacteria, потому что ни одна из стратегий скрининга, о которых сообщалось до настоящего времени, не использовала обычные AHL-чувствительные биосенсоры. Хотя наш предварительный скрининг АГЛ-опосредованного чувства кворума у ​​актинобактерий с использованием АГЛ-чувствительных биосенсоров подтверждает эту гипотезу (личное наблюдение), дальнейшее исследование поможет установить, выделяют ли определенные штаммы актинобактерий АГЛ или существуют другие пока неизвестные соединения, способные высвобождать АГЛ. на которые реагируют эти AHL-чувствительные биосенсоры.В любом случае представляет интерес производство АГЛ актинобактериями или чувствительными к АГЛ биосенсорами, реагирующими на не-АГЛ-сигналы, продуцируемые актинобактериями. В этом контексте Ян и соавт. (2009) отметили, что N -гексаноил-DL-гомосеринлактон (C 6 -HSL) взаимодействует с рецептором S. coelicolor GBL (ScbR), активируя экспрессию gfp , предполагая, что такие межтиповые взаимодействия не являются невозможными. Однако в нашем случае имеет место обратное наблюдение, не находящее поддержки в существующей литературе.Это интересное и важное наблюдение как для штаммов биосенсоров, так и для актинобактерий, поэтому оно нуждается в дальнейшей проверке. По нашему мнению, мы считаем, что такие стратегии перекрестного скрининга могут привести к открытию новых молекул.

    Скрининг на определение кворума у ​​актинобактерий: ограничения и улучшения

    Основным ограничением является отсутствие хороших биосенсорных систем, которые могут реагировать на очень небольшое количество и диапазон сигнальных молекул. Чувство кворума может быть убедительно продемонстрировано только при выделении сигнальной молекулы с последующей детерминацией ее структуры и ее способности регулировать фенотипы при внешнем добавлении в среду.Однако культуры Actinobacteria, такие как Streptomyces , обычно продуцируют очень небольшое количество ГБЛ, и для их очистки обычно требуется органическая экстракция больших (например, >400 л) объемов отработанной культуральной среды. Существующие сенсорные штаммы не реагируют ни на такое малое количество, ни на диапазон продуцируемых ГБЛ, особенно с более длинными боковыми цепями С2. Вероятно, это основная причина, по которой известна структура лишь нескольких ГБЛ. Фактически по этим техническим и экономическим причинам Healy et al.(2009) не определили структуру ГБЛ из S. acidiscabies и вместо этого использовали альтернативную стратегию, чтобы косвенно доказать взаимодействие ГБЛ с его родственным рецептором (см. ниже). Напротив, штаммы биосенсоров, реагирующие на АГЛ, такие как Chromobacterium violaceum CV026 (McClean et al., 1997) и рекомбинантные штаммы Escherichia coli на основе gfp , содержащие плазмиды pJBA89, pJBAen113 и pJBAen113 al., 2001) реагируют на широкий спектр соединений АГЛ даже в наномолярных количествах.Их наличие значительно повысило обнаружение эмиссионного кворума, опосредованного AHL в грамотрицательных бактериях. Учитывая это, существует немедленная потребность в усилиях по созданию аналогичной биосенсорной системы, которая может обнаруживать широкий спектр ГБЛ. Чтобы двигаться вперед, приоритетом должно быть получение большего количества данных из известных ГБЛ и механизмов, которые они регулируют. Эта новая информация значительно добавит к разработке таких широкополосных биосенсоров, отзывчивающих GBL.

    Не многие актинобактерии проявляют AI-2-опосредованное чувство кворума, типичное для многих других грамположительных организмов.Однако это может быть связано с его чувствительностью к высокому уровню глюкозы и кислому pH в культуральной среде, которые обладают сильным ингибирующим эффектом. При скрининге активности AI-2 в супернатантах культур бифидобактерий Sun et al. (2014) не смогли обнаружить какой-либо активности в MRSc, т.е. стандартной культуральной среде для бифидобактерий. MRSc содержит 20 г/л глюкозы, а конечными продуктами метаболизма бифидобактерий на гексозах являются в основном уксусная и молочная кислоты. Испытывая V. harveyi BB170, известного продуцента AI-2, при различных значениях pH, авторы пришли к выводу, что кислый pH отрицательно влияет на обнаружение.Активность AI-2 снижалась примерно до 40% при рН 4, т.е. рН, наблюдаемом в супернатантах бифидобактерий, и при 0,25 г/л глюкозы (Sun et al., 2014). Напротив, во время анализов регулятора ответа сигнальной молекулы, ArpA, только те, которые являются кислыми (pH ~ 5), связывают ауторегулятор при тестировании; основные белки – нет (Willey and Gaskell, 2011). Следовательно, информация о чувствительности существующих сигнальных молекул является гарантированной. Как только эта информация будет получена, она, вероятно, улучшит существующие стратегии скрининга.

    Более осуществимым подходом является поиск гомологов гена рецептора ауторегулятора (Willey and Gaskell, 2011). Как показано Сантосом и соавт. (2012), эти гены имеют высокую степень сходства в пределах данного таксона, и разработка вырожденных праймеров для их ПЦР-амплификации и секвенирования является лучшей стратегией. Используя аналогичную стратегию, мы смогли секвенировать большинство гомологов генов, отвечающих за кворум, из рода Aeromonas и показать, что эта система повсеместно присутствует у всех видов этого рода (Jangid et al., 2007). Благодаря достижениям в технологии секвенирования и снижению затрат проведение метагеномных исследований с использованием аналогичного подхода будет очень простым и, вероятно, позволит получить огромную информацию, которая до сих пор скрыта и неиспользована. Тем не менее, такие новые стратегии должны применяться с осторожностью и тщательным планированием. Далее, простое присутствие гена никоим образом не свидетельствует о функциональной сигнальной системе. Следовательно, клонирование таких структурных генов в системе экспрессии — единственный способ подтвердить ее активность.Однако для такой стратегии крайне важно получить интактный функциональный белок, а затем использовать очищенные белки для дальнейшего исследования.

    Недавно были описаны некоторые новые методологии на основе рецепторов. Чтобы обойти проблему необходимости большого количества культур, Yang et al. (2005) сообщили об альтернативной системе обнаружения с использованием ScbR, рецепторного белка из S. coelicolor и тандемной масс-спектрометрии с электрораспылением (ESI-MS/MS). Используя успех технологии аффинного захвата в протеомных исследованиях, авторы разработали рекомбинантные рецепторы бутанолидов, такие как ArpA из S.griseus , FarA из S. lavendulae , BarA из S. virginiae и SpbR из S. pristinaespiralis и использовали их в качестве молекул аффинного захвата для улавливания бутанолидов с последующим анализом МС для идентификации. Этот метод позволяет выделить бутанолиды всего из 100 мл культурального бульона S. coelicolor . Кроме того, он позволяет обнаруживать систему восприятия кворума в тех случаях, когда взаимодействие между сигнальной молекулой и родственным ей рецептором ингибируется при кислом рН и высоком уровне глюкозы.Например, Хили и др. (2009) обнаружили фрагментные ионы, связанные очищенными рецепторами GBL из S. acidiscabies . Эти ионы показали массу, которая соответствовала молекулам, имеющим лактонные функциональные группы, такие как обнаруженные в соединениях ГБЛ. Таким образом, эта стратегия может быть полезна для штаммов с идентифицированными рецепторами ГБЛ, но где взаимодействие не может быть доказано.

    Доступность разнообразного набора биосенсорных плазмид, вероятно, повысит частоту обнаружения систем распознавания кворума Actinobacterial.Недавно Ян и др. (2009) разработали gfp -содержащую E. coli- бесклеточную систему для обнаружения ГБЛ в Streptomyces. В этой системе определения кворума ScbR gfp слит ниже сайта связывания ДНК с рецептором GBL S. coelicolor , ScbR. Присутствие очищенного His-меченого ScbR и родственного GBL приводит к флуоресценции. Эта система позволяет обойти проблемы проникновения в клеточную стенку и может использоваться для высокопроизводительного скрининга, поскольку позволяет проводить анализы в течение 4 часов.Кроме того, взаимодействие белок-лиганд можно легко контролировать без использования радиоизотопов и акриламидных гелей. Точно так же Hsiao et al. (2009) использовали ScbR и его ДНК-мишень для контроля экспрессии гена устойчивости к канамицину в присутствии родственного ему GBL. Эта новая чувствительная репортерная система также позволяет обнаруживать небольшие количества ГБЛ и те, которые трудно обнаружить. Авторы предполагают, что, изменив время приготовления экстракта из клеток, можно улучшить обнаружение других ГБЛ из разных штаммов.Биоанализ с канамицином, вероятно, облегчит крупномасштабный скрининг продуцентов ГБЛ из-за его более высокой чувствительности к широкому спектру ГБЛ, чем обычно используемый биоанализ.

    Хотя эти новые подходы, вероятно, облегчат обнаружение дополнительных ГБЛ, одним важным ограничением является то, что большинство из них нацелены на обнаружение ГБЛ из актинобактерий, особенно Streptomyces . Следовательно, необходимо подробное исследование других не-GBL-опосредованных систем восприятия кворума, чтобы получить представление о задействованных механизмах и, таким образом, разработать стратегии для расширения спектра обнаружения сигнальных молекул.

    Активность подавления кворума у ​​актинобактерий

    В связи с постоянным ростом числа устойчивых к антибиотикам бактерий необходимо искать альтернативные стратегии контроля их распространения. Поскольку большинство патогенов регулируют свою вирулентность с помощью чувства кворума, оно стало наиболее востребованной альтернативной мишенью для контроля их распространения. Химическая инактивация грамотрицательных АГЛ посредством щелочного гидролиза известна уже довольно давно. Однако ферментативная деградация сигнальных молекул в настоящее время является наиболее изученной областью подавления кворума для ограничения роста многих патогенов животных и растений.Ферменты подавления кворума действуют одним из двух способов: (1) аналогично химическому гидролизу кольца, ацил-гомосерин генерируется лактоназами AHL; и (2) амидная связь расщепляется АГЛ-ацилазами. Скрининг этих ферментов в различных экосистемах показал большой потенциал. Например, бактерии, разлагающие АГЛ, могут составлять 5–15% от общего числа культивируемых бактерий в почве и ризосфере (Latour et al., 2013). Несмотря на небольшой размер, это существенный и важный ресурс для разработки рецептур биоконтроля.Поэтому скрининг таких ферментов становится все более важным.

    Способность актинобактерий производить бесчисленные вторичные метаболиты, ферменты и коммерчески важные биомолекулы привлекла исследователей к изучению этого типа на предмет их роли в подавлении кворума. Эндофитные актиномицеты и их ферменты AHL-лактоназы продемонстрировали большой потенциал в этом отношении (Chankhamhaengdecha et al., 2013). Авторы предприняли первую попытку скрининга актиномицетов, продуцирующих ферменты подавления кворума, из почвы и тканей растений.При 51,5% тестируемых штаммов, обладающих кворум-гашающей активностью, эндофитные актиномицеты обладали активностью с большей частотой, чем почвенные изоляты на уровне 36,9%, демонстрируя большое разнообразие и обилие АГЛ-деградирующих актиномицетов. Хотя можно было бы подумать, что подавление кворума наиболее полезно для организмов, которые производят сигналы, позволяющие им использовать их в качестве источника энергии и источника азота (Flagan et al., 2003), известно, что организмы, которые не производят сигналы, также подавляют их, по-видимому, чтобы получить преимущество перед общающимися видами бактерий в той же самой экологической нише (Wuster and Babu, 2008).Например, Rhodococcus и Microbacterium могут разрушать сигналы AHL, не обладая какой-либо известной способностью их производить. На самом деле, для последнего нет никаких признаков чувства кворума, даже биоинформатических. Следовательно, оправдано проведение большего количества таких скрининговых исследований окружающей среды, нацеленных на актинобактерии.

    Определенные представители филума Actinobacteria также продемонстрировали значительный потенциал в агросреде из-за их активности подавления кворума.Некоторые актинобактерии обладают способностью колонизировать поверхности растений и тем самым исключать патогены растений либо за счет конкуренции, либо за счет ингибирования выработкой антибиотиков (Selvakumar et al., 2014). Всего за последнее десятилетие родов актинобактерий насчитывается шесть: Arthrobacter (Flagan et al., 2003), Microbacterium (Wang et al., 2012), Mycobacterium (Chen and Xie, 2011), Nocardioides . (Yoon et al., 2006), Rhodococcus (Park et al., 2006; Latour et al., 2013) и Streptomyces (Chen and Xie, 2011; Ooka et al., 2013) известны своей активностью по подавлению кворума. Сообщается, что представители этих родов, существующие как симбионты растений или как эндофиты, проживающие в растениях-хозяевах, не вызывая симптомов заболевания, продуцируют АГЛ-инактивирующие ферменты. Фактически, Rhodococcus имеет необычно большое количество АГЛ-инактивирующих лактоназ (Wuster and Babu, 2008), которые могут играть роль во внутриклеточном метаболизме лактоновых соединений, таких как ГБЛ (Uroz et al., 2005). Из-за его высокой активности по разложению АГЛ штамм R. erythropolis R138 использовался в качестве агента биологической борьбы для предотвращения мягкой гнили на растениях. Генетические данные свидетельствуют о том, что путь катаболизма лактона у штамма может быть не единственным путем инактивации АГЛ. Кроме того, он обладает множеством гомологов различных катаболических ферментов, что повышает метаболическую универсальность вида (Latour et al., 2013). Недавно сообщалось, что еще два штамма R. erythropolis , PR4 и MM30 морского происхождения, ферментативно расщепляют N -оксододеканоил- L -гомосеринлактон (Romero et al., 2011). Точно так же почвенный изолят Nocardioides kongjuensis A2–4 T способен расти с N-гексаноил- L -гомосеринлактоном в качестве единственного источника углерода, что свидетельствует о том, что его гасящая способность заслуживает изучения в отношении патогенов растений (Yoon et al. ., 2006). Кроме того, активность фермента лактоназы, разрушающего АГЛ, также была обнаружена у ассоциированной с листьями картофеля Microbacterium testaceum StLB037 (Wang et al., 2012). Недавно сообщалось, что видов Arthrobacter ингибируют чувство кворума при межфилумном взаимодействии (Igarashi et al., 2015). Штамм PGVB1 производит arthroamide и turnagainolide, которые показали сильное ингибирование agr- сигнального пути зондирования кворумном в золотистого стафилококка при 5-10 мкМ, не проявляя токсичности клеток. Кроме того, основной метаболит piericidin A1, секретируемый Streptomyces Sp. TOHO-Y209 и TOHO-O348 продемонстрировали ингибирующую активность в отношении определения кворума в отношении C. violaceum CV026 (Ooka et al., 2013). Метаболиты класса пиерицидинов являются известными ингибиторами НАДН-убихиноноксидоредуктазы, при этом А1 специфически ингибирует как митохондриальные, так и бактериальные НАДН-убихиноноксидоредуктазы.Эти исследования показывают, что актинобактерии представляют собой уникальную систему, которая при правильном использовании, вероятно, сыграет важную роль в борьбе с распространением патогенов растений и человека.

    Заключение

    Огромное метаболическое и филогенетическое разнообразие актинобактерий дает уникальную возможность изучить их многофакторные способности для биотехнологических применений. Чувство кворума — одно из таких свойств, которое явно недостаточно изучено в этом типе. Основываясь на известной ограниченной информации, системы определения кворума у ​​Actinobacteria демонстрируют значительное разнообразие с точки зрения типов сигналов и механизмов, которые они контролируют.Однако внутри филума существует таксоноспецифическая сегрегация. Например, GBL-опосредованная регуляция не ограничивается только Streptomyces , но также видоспецифична. Следовательно, межвидовая передача сигналов, вероятно, расширит список соединений и механизмов, участвующих в ощущении кворума. Отсутствие хороших систем обнаружения является основным ограничением для дальнейшего изучения коммуникационной системы актинобактерий. Разработка новых систем, которые могут реагировать на более широкий спектр сигналов, причем в очень малых количествах, является потребностью часа.Дальнейшее исследование с использованием этих систем внутри и между несколькими таксонами, вероятно, обнаружит еще большее разнообразие сигналов. Точно так же способность Actinobacteria подавлять кворум демонстрирует большой потенциал, особенно благодаря их использованию в качестве агентов биологической борьбы с патогенами растений и для контроля распространения устойчивых к антибиотикам организмов. Однако для полного использования потенциала подавления кворума требуется систематическая проверка конкретных экосистем. Используя знания, полученные в результате глубокого понимания существующих систем распознавания кворума, актинобактерии, вероятно, проявят более широкий набор свойств, которые могут иметь серьезные последствия для здоровья растений, животных и человека.

    Вклад авторов

    KJ и AP разработали обзор. SM и UP сделали ссылки, предварительный анализ последовательности и компиляцию данных. KJ и AP доработали структуру обзора, проанализировали данные последовательности и написали обзор.

    Финансирование

    Работа выполнена при поддержке Департамента биотехнологии (DBT; грант № BT/PR/0054/NDB/52/94/2007) правительства Индии в рамках проекта «Создание коллекции микробных культур».

    Заявление о конфликте интересов

    Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могли бы быть истолкованы как потенциальный конфликт интересов.

    Подтверждение

    Спасибо Drita Misra и Rohit Sharma за помощь в подготовке рисунков 1 и 3 соответственно.

    Дополнительный материал

    Дополнительный материал к этой статье можно найти в Интернете по адресу: https://www.frontiersin.org/article/10.3389/fmicb.2016.00131

    .

    Ссылки

    Andersen, J.B., Heydorn, A., Hentzer, M., Eberl, L., Geisenberger, O., Christensen, B.B., et al. (2001). gfp Сенсорные системы на основе N-ацилгомосерин-лактона для обнаружения бактериальной коммуникации. Заяв. Окружающая среда. микробиол. 67, 575–585. doi: 10.1128/AEM.67.2.575-585.2001

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Bainton, N.J., Bycroft, B.W., Chhabra, S.R., Stead, P., Gledhill, L., Hill, P.J., et al. (1992). Общая роль аутоиндуктора lux в контроле биосинтеза антибиотиков бактериальными клетками у Erwinia . Ген 116, 87–91. дои: 10.1016/0378-1119(92)-Z

    Полнотекстовая перекрестная ссылка | Академия Google

    Банайи, Н., Jacobs, WR Jr., and Ernst, JD (2006). Регуляция Mycobacterium tuberculosis whiB3 в легких и макрофагах мышей. Заразить. Иммун. 74, 6449–6457. doi: 10.1128/IAI.00190-06

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Барбер, К.Е., Танг, Дж.Л., Фенд, Дж.К., Пан, М.К., Уилсон, Т.Дж.Г., и Слейтер, Х. (1997). Новая регуляторная система, необходимая для патогенности Xanthomonas campestris , опосредована небольшой диффундирующей сигнальной молекулой. Мол. микробиол. 24, 555-566. doi: 10.1046/j.1365-2958.1997.3721736.x

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Бек фон Бодман, С., и Фарранд, С.К. (1995). Биосинтез капсульного полисахарида и патогенность Erwinia stewartii требуют индукции аутоиндуктором N-ацилгомосеринлактона. Дж. Бактериол. 177, 5000-5008.

    Академия Google

    Бхарати, Б.К., и Чаттерджи, Д. (2013). Кворумское чувствительность и патогенез: роль малых сигнальных молекул в бактериальном упорстве. Курс. науч. 105, 643–656.

    Академия Google

    Бхукья, Х., Бхуджбалрао, Р., Битра, А., и Ананд, Р. (2014). Структурно-функциональная основа регуляции транскрипции белком семейства TetR CprB из S. coelicolor A3(2). Рез. нуклеиновых кислот. 42, 10122–10133. doi: 10.1093/nar/gku587

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Чанкхамхаенгдеча, С., Хонгвиджит, С., Шричайсупакит, А., Чарнчай, П.и Панбангред В. (2013). Эндофитные актиномицеты: новый источник потенциальных ферментов, разрушающих ацилгомосеринлактон. Биомед Рез. Междунар. 2013, 782847. doi: 10.1155/2013/782847

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Чой С.У., Ли С.К., Хван Ю.И., Киношита Х. и Нихира Т. (2003). Гамма-бутиролактоновые ауторегуляторы и рецепторные белки у не- Streptomyces актиномицетов, продуцирующих коммерчески важные вторичные метаболиты. Арх. микробиол. 180, 303–307. doi: 10.1007/s00203-003-0591-y

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Чой С.У., Ли С.К., Хван Ю.И., Киношита Х. и Нихира Т. (2004). Клонирование и функциональный анализ путем разрушения гена, кодирующего рецептор ауторегулятора γ-бутиролактона из Kitasatospora setae . J. Бактериол. 186, 3423–3430. doi: 10.1128/JB.186.11.3423-3430.2004

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Коэнье, Т., Питер, Е. и Нелис, Х. Дж. (2007). Биофильм Формирование на Propionibacterium Acnes связано с повышенной устойчивостью к антимикробным агентам и повышенной продукции факторов предполагаемых вирулентности. Рез. микробиол. 158, 386-392. doi: 10.1016 / j.resmic.2007.02.001

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Curragh, H., Flynn, О., Ларкин, М. Дж., Стаффорд, Т. М., Гамильтон, Дж. Т. и Харпер, Д. Б. (1994). Деградация галогенана и ассимиляция на Rhodococcus Rhodochrous NCIMB 13064. Микробиология 140, 1433–1442. doi: 10.1099 / 00221287-140-6-1433

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Эберл Л., Кристиансенс С.Р., Молин С. и Гивсков М. (1996). Дифференциация Serratia LiqueFaciens в роя клетки контролируется выражением магистрального оперона FLHD . J. Бактериол. 178, 554-559.

    Реферат PubMed | Академия Google

    Фельсенштейн, Дж. (1985).Пределы достоверности филогений: подход с использованием бутстрапа. Эволюция 39, 783–791. дои: 10.2307/2408678

    Полнотекстовая перекрестная ссылка | Академия Google

    Flagan, S., Ching, WK, and Leadbetter, JR (2003). Штамм VAI-A Arthrobacter использует продукты инактивации ацилгомосеринлактона и стимулирует биодеградацию сигнала кворума с помощью Variovorax paradoxus . Заяв. Окружающая среда. микробиол. 69, 909–916. doi: 10.1128/AEM.69.2.909-916.2003

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Fuqua, W.C., and Winans, S.C. (1994). Регуляторная система типа LuxR-LuxI активирует конъюгальный перенос плазмиды Agrobacterium Ti в присутствии метаболита опухоли растения. J. Бактериол. 176, 2796–2806.

    Реферат PubMed | Академия Google

    Fuqua, W.C., Winans, S.C., and Greenberg, E.P. (1994). Чувство кворума у ​​бактерий: семейство LuxR-LuxI регуляторов транскрипции, реагирующих на плотность клеток. J. Бактериол. 176, 269–275.

    Реферат PubMed | Академия Google

    Fuqua, W.C., Winans, S.C., and Greenberg, E.P. (1996). Перепись и консенсус в бактериальных экосистемах: семейство регуляторов, чувствительных к кворуму, LuxR-LuxI. год. Преподобный Микробиолог. 50, 727–751. doi: 10.1146/annurev.micro.50.1.727

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Гаррити, Г. М., Уинтерс, М., и Сирлз, Д. Б. (2001). Руководство Берджи по систематической бактериологии , 2-е изд.Нью-Йорк, штат Нью-Йорк: Спрингер.

    Академия Google

    Готтельт М., Хескет А., Бунет Р., Пури П. и Такано Э. (2012). Характеристика природного варианта сигнального рецептора γ-бутиролактона. Рез. BMC. Примечания 5:379. дои: 10.1186/1756-0500-5-379

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Хили, Ф.Г., Итон, К.П., Лимсиричай, П., Олдрич, Дж.Ф., Пахарь, А.К., и Кинг, Р.Р. (2009). Характеристика гомологов γ-бутиролактонного ауторегуляторного сигнального гена у продуцента поликетида ангуциклинона WS5995B Streptomyces acidiscabies . J. Бактериол. 191, 4786–4797. doi: 10.1128/JB.00437-09

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Хориноути, С., и Беппу, Т. (1993). Биосинтез А-фактора и стрептомицина у Streptomyces griseus . Антони Ван Левенгук 64, 177–186. дои: 10.1007/BF00873026

    Полнотекстовая перекрестная ссылка | Академия Google

    Сяо, Н.Х., Накаяма, С., Мерло, М.Е., де Врис, М., Бунет, Р., Китани, С., и соавт. (2009).Анализ двух дополнительных сигнальных молекул в Streptomyces coelicolor и разработка репортерной системы, специфичной для бутиролактона. Хим. биол. 16, 951–960. doi: 10.1016/j.chembiol.2009.08.010

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Игараси Ю., Ямамото К., Фукуда Т., Шодзима А., Накаяма Дж., Карро Л. и др. (2015). Артроамид, циклический депсипептид с ингибирующей активностью в отношении кворума из Arthrobacter sp. J. Nat. Произв. 78, 2827–2831. doi: 10.1021/acs.jnatprod.5b00540

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Джонс, А.Л., и Гудфеллоу, М. (2012). «Род IV. Rhodococcus (Zopf 1891) исправлен. Goodfellow, Alderson and Chun 1998a», в Bergey’s Manual of Systematic Bacteriology-Actinobacteria , 2nd Edn, Vol. 5, ред. М. Гудфеллоу, П. Кампфер, Х. Дж. Буссе, М. Э. Трухильо, К. Судзуки, В. Лундвиг и др. (Нью-Йорк, штат Нью-Йорк: Спрингер), 437–464.

    Академия Google

    Хохлов А.С., Товарова И.И., Борисова Л.Н., Плинер С.А., Шевченко Л.А., Корницкая Ела и др. (1967). А-фактор, ответственный за биосинтез стрептомицина мутантными штаммами Actinomyces streptomycini . Докл. акад. 177, 232–235.

    Академия Google

    Кимура, М. (1980). Простой метод оценки эволюционной скорости замены оснований посредством сравнительных исследований нуклеотидных последовательностей. Дж. Мол. Эволь 16, 111-120. DOI: 10.1007 / BF01731581

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Клеребезем, М., Квадри, Л. Е., Кууперы, О. П. и де Вос, В. М. (1997). Кворум, чувствуясь пептидными феромонами и двумя компонентными системами-трансдукционными системами в грамположительных бактериях. Мол. микробиол. 24, 895-904. doi: 10.1046/j.1365-2958.1997.4251782.x

    Полнотекстовая перекрестная ссылка | Академия Google

    КОН, С. Л., Сэм, С.K., Yin, W.F., Tan, L.Y., Krishnan, T., Chong, Y.M., et al. (2013). Растительного происхождения, натуральные продукты в качестве источников анти-кворума соединения. Датчики 13, 6217–6228. doi: 10.3390/s130506217

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Латур, Х., Барбе, К., Чейн, А., Groboillot, А. и Бурини, Дж Ф. (2013). + Rhodococcus erythropolis и его γ-лактон катаболического пути: необычная система BioControl, что нарушает патоген кворума связь. Агрономия 3, 816–838. doi: 10.3390/agronomy3040816

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Лю, Г., Чатер, К. Ф., Чандра, Г., Ниу, Г. и Тан, Х. (2013). Молекулярная регуляция биосинтеза антибиотиков у Streptomyces . Микробиолог. Мол. биол. Ред. 77, 122–143. doi: 10.1128/MMBR.00054-12

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Людвиг В., Юзеби Дж. и Уитмен В. Б.(2012). «Таксономический очерк филума Actinobacteria », в Bergey’s Manual of Systematic Bacteriology — Actinobacteria , 2nd Edn, Vol. 5, ред. М. Гудфеллоу, П. Кампфер, Х. Дж. Буссе, М. Э. Трухильо, К. Судзуки, В. Лундвиг и др. (Нью-Йорк, штат Нью-Йорк: Спрингер), 29–31.

    Академия Google

    Лвин, С. М., Кимбер, И., и Макфадден, Дж. П. (2014). Акне, чувство кворума и опасность. клин. Эксп. Дерматол. 39, 162–167. doi: 10.1111/ced.12252

    Реферат PubMed | Полнотекстовая перекрестная ссылка

    Магнусон, Р., Соломон, Дж., и Гроссман, А.Д. (1994). Биохимическая и генетическая характеристика феромона компетентности B. subtilis . моб. 77, 207–216. дои: 10.1016/0092-8674(94)-1

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Мэнфилд, М., и Тернер, С.Л. (2002). Чувство кворума в контексте: от молекулярной биологии к микробной экологии. Микробиология 148, 3762–3764. дои: 10.1099/00221287-148-12-3762

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Матцингер, П.(1994). Терпимость, опасность и большая семья. год. Преподобный Иммунол. 12, 991–1045. doi: 10.1146/annurev.iy.12.040194.005015

    Полнотекстовая перекрестная ссылка | Академия Google

    McClean, K.H., Winson, M.K., Fish, L., Taylor, A., Chhabra, S.R., Camara, M., et al. (1997). Чувство кворума и Chromobacterium violaceum : использование продукции и ингибирования виолацеина для обнаружения лактонов N-ацилгомосерина. Микробиология 143, 3703–3711.дои: 10.1099/00221287-143-12-3703

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Нильсон, К. Х., и Гастингс, Дж. В. (1979). Бактериальная биолюминесценция: ее контроль и экологическое значение. Микробиолог. Ред. 43, 496–518.

    Реферат PubMed | Академия Google

    Нисида Х., Ониши Ю., Беппу Т. и Хориноути С. (2007). Эволюция гамма-бутиролактонсинтаз и рецепторов у Streptomyces . Окружающая среда.микробиол. 9, 1986–1994 гг. doi: 10.1111/j.1462-2920.2007.01314.x

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Оока К., Фукумото А., Яманака Т., Шимада К., Исихара Р., Анзай Ю. и др. (2013). Пиерицидины, новые ингибиторы восприятия кворума против Chromobacterium violaceum CV026, из Streptomyces sp. ТОХО-Y209 и ТОХО-O348. Открытый J. Med. хим. 3, 93–99. doi: 10.1038/ja.2015.126

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Парк, С.Ю., Хванг, Б.Дж., Шин, М.Х., Ким, Дж.А., Ким, Х.К., и Ли, Дж.К. (2006). N-ацилгомосеринлактоназа-продуцент Rhodococcus spp. с различной активностью, разрушающей АГЛ. FEMS Microbiol. лат. 261, 102–108. doi: 10.1111/j.1574-6968.2006.00336.x

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Qin, X., Singh, K.V., Weinstock, G.M., and Murray, B.E. (2000). Эффекты генов Enterococcus faecalis fsr на продукцию желатиназы и сериновой протеазы и вирулентность. Заразить. Иммун. 68, 2579–2586. doi: 10.1128/IAI.68.5.2579-2586.2000

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Ресио, Э., Колинас, А., Румберо, А., Апарисио, Дж. Ф., и Мартин, Дж. Ф. (2004). Фактор PI, новый тип индуктора восприятия кворума, вызывает выработку пимарицина у Streptomyces natalensis . J. Biol. хим. 279, 41586–41593. doi: 10.1074/jbc.M402340200

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Ромеро, Р., Мартин-Куадрадо, А.Б., Рока-Ривада, А., Кабельо, А.М., и Отеро, А. (2011). Гашение кворма культивируемых бактерий из плотных морских прибрежных микробных сообществ. FEMS микробиол. Экол. 75, 205–217. doi: 10.1111/j.1574-6941.2010.01011.x

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Сайтоу, Н., и Ней, М. (1987). Метод соседнего соединения: новый метод реконструкции филогенетических деревьев. Мол. биол. Эвол. 4, 406–425.

    Академия Google

    Сантос, К.Л., Коррейя-Невес М., Морадас-Феррейра П. и Мендес М.В. (2012). Знакомство с регуляторами LuxR актинобактерий: филогеномное распространение и функциональное разнообразие. PLoS ONE 7:e46758. doi: 10.1371/journal.pone.0046758

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Selvakumar, G., Panneerselvam, P., and Ganeshamurthy, A.N. (2014). «Полезность разнообразия и потенциал актинобактерий в агроэкосистеме», в Бактериальное разнообразие в устойчивом сельском хозяйстве , изд.Д. К. Махешвари (Cham: Springer International Publishing), 23–40.

    Академия Google

    Шарма, И. М., Печиаппан, А., и Чаттерджи, Д. (2014). Чувство кворума и формирование биопленок у микобактерий: роль c-di-GMP и методы изучения этого вторичного мессенджера. IUBMB Life 66, 823–834. doi: 10.1002/iub.1339

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Соломон, Дж. М., Магнусон, Р., Шривастава, А., и Гроссман, А. Д. (1995).Конвергентные сенсорные пути опосредуют реакцию на два фактора внеклеточной компетентности у Bacillus subtilis . Гены Дев. 9, 547–558. doi: 10.1101/gad.9.5.547

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Стурме, М. Х., Клиребезем, М., Накаяма, Дж., Аккерманс, А. Д., Вога, Э. Э., и де Вос, В. М. (2002). Связь между клетками с помощью аутоиндуцирующих пептидов у грамположительных бактерий. Антони Ван Левенгук 81, 233–243.дои: 10.1023/A:10205225

    Полнотекстовая перекрестная ссылка | Академия Google

    Сунь, З., Хе, X., Бранкаччо, В. Ф., Юань, Дж., и Ридель, К. У. (2014). Бифидобактерии проявляют LuxS-зависимую активность аутоиндуктора 2 и образование биопленок. PLoS ONE 9:e88260. doi: 10.1371/journal.pone.0088260

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Такано, Э. (2006). γ-бутиролактоны: Streptomyces сигнальные молекулы, регулирующие выработку и дифференцировку антибиотиков. Курс. мнение микробиол. 9, 287–294. doi: 10.1016/j.mib.2006.04.003

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Такано Э., Нихира Т., Хара Ю., Джонс Дж. Дж., Гершатер С. Дж., Ямада Ю. и др. (2000). Очистка и структурное определение SCB1, γ-бутиролактона, который вызывает выработку антибиотика в Streptomyces coelicolor A3(2). J. Biol. хим. 275, 11010–11016. doi: 10.1074/jbc.275.15.11010

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Тамура, К., Стечер Г., Петерсон Д., Филипски А. и Кумар С. (2013). MEGA6: молекулярно-эволюционный генетический анализ версии 6.0. Мол. биол. Эвол. 30, 2725–2729. doi: 10.1093/molbev/mst197

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Уроз С., Чабра С. Р., Камара М., Уильямс П., Огер П. и Дессо Ю. (2005). Молекулы N-ацилгомосеринлактона, чувствительные к кворуму, модифицируются и расщепляются Rhodococcus erythropolis W2 как за счет амидолитической, так и за счет новой оксидоредуктазной активности. Микробиология 151, 3313–3322. doi: 10.1099/мик.0.27961-0

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Вера-Кабрера, Л., Ортис-Лопес, Р., Элизондо-Гонсалес, Р., и Окампо-Кандиани, Дж. (2013). Полный анализ последовательности генома Nocardia brasiliensis HUJEG-1 выявил сапробный образ жизни и гены, необходимые для патогенеза человека. PLoS ONE 8:e65425. doi: 10.1371/journal.pone.0065425

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Ван, В.З., Морохоши Т., Сомея Н. и Икеда Т. (2012). Разнообразие и распространение активности, разрушающей N-ацилгомосеринлактон (АГЛ), и АГЛ-лактоназы (AiiM) в роде Microbacterium . Микробы Окружающая среда. 27, 330–333. дои: 10.1264/jsme2.ME11341

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Вебер, Т., Вельцель, К., Пельцер, С., Венте, А., и Воллебен, В. (2003). Использование генетического потенциала стрептомицетов, продуцирующих поликетиды. Дж.Биотехнолог. 106, 221–232. doi: 10.1016/j.jbiotec.2003.08.004

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Вустер, А., и Бабу, М.М. (2008). Химические молекулы, которые регулируют транскрипцию и облегчают межклеточную коммуникацию. Энцикл Уайли. хим. биол. 1–11. дои: 10.1002/9780470048672.wecb501

    Полнотекстовая перекрестная ссылка | Академия Google

    Yang, Y.H., Joo, H.S., Lee, K., Liou, K.K., Lee, H.C., Sohng, J.K., et al.(2005). Новый метод обнаружения бутанолидов в культуральном бульоне Streptomyces coelicolor с использованием His-меченого рецептора (ScbR) и масс-спектрометрии. Заяв. Окружающая среда. микробиол. 71, 5050–5055. doi: 10.1128/AEM.71.9.5050-5055.2005

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Yang, Y.H., Kim, T.W., Park, S.H., Lee, K., Park, H.Y., Song, E., et al. (2009). Бесклеточная система на основе Escherichia coli для скрининга молекул, чувствительных к кворуму, взаимодействующих с белками рецептора кворума Streptomyces coelicolor . Заяв. Окружающая среда. микробиол. 75, 6367–6372. doi: 10.1128/AEM.00019-09

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Юн, Дж. Х., Ли, Дж. К., Юнг, С. Ю., Ким, Дж. А., Ким, Х. К., и О, Т. К. (2006). Nocardioides kongjuensis sp. nov., бактерия, разлагающая N-ацилгомосеринлактон. Междунар. Дж. Сист. Эвол. микробиол. 56, 1783–1787 гг. doi: 10.1099/ijs.0.64120-0

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    ПЛОС ОДИН: Стафилококк

    Йипэн Ван, Чжи Чжан, [ … ], Рен Лай

    Онс Бушами, Асия Бен Хассен, Эрминия де Ленкастр, Мария Мирагая

    Кеннет С. Малкольм, Дженнифер Э. Крет, [ … ], Джерри А. Ник

    Стивен Дж. Хоггард, Питер Д. Уилсон, Эндрю Дж. Битти, Адам Дж. Стоу

    Соломон Кристофер, Реджина Мариам Вергис, [ … ], Бен Саймонс Купер

    Мелани Фалорд, Ульрике Мэдер, [ … ], Тарек Мсадек

    Адриана Ренцони, Диего О. Андрей, [ … ], Уильям Л. Келли

    Симона Айманнс, Стефани Мауэрер, [ … ], Барбара Спеллерберг

    Рэйчел А.Лиллибридж, Стивен Ю.К. Тонг, Филип М. Гиффард, Дебора С. Холт

    Себастьян Дж. ван Хал, Марк Джонс, Иэн Б. Госбелл, Дэвид Л. Патерсон

    Хонг-Лин Су, Сиу-Хонг Лин, [ … ], Цзян-Джен Лин

    Чарльз Ф. Беллоуз, Бенджамин М. Уитли, [ … ], Лиза А.Моричи

    .

    Добавить комментарий

    Ваш адрес email не будет опубликован.